Incidental Mutation 'R6271:Sgce'
ID507329
Institutional Source Beutler Lab
Gene Symbol Sgce
Ensembl Gene ENSMUSG00000004631
Gene Namesarcoglycan, epsilon
Synonymse-SG
MMRRC Submission 044379-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock #R6271 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location4674350-4747207 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4730015 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 70 (K70E)
Ref Sequence ENSEMBL: ENSMUSP00000111240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004750] [ENSMUST00000090686] [ENSMUST00000101677] [ENSMUST00000115577] [ENSMUST00000115579] [ENSMUST00000126151] [ENSMUST00000133306]
Predicted Effect probably benign
Transcript: ENSMUST00000004750
SMART Domains Protein: ENSMUSP00000004750
Gene: ENSMUSG00000004631

DomainStartEndE-ValueType
CADG 49 157 1.86e-10 SMART
low complexity region 412 423 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090686
SMART Domains Protein: ENSMUSP00000088185
Gene: ENSMUSG00000004631

DomainStartEndE-ValueType
CADG 49 157 1.86e-10 SMART
low complexity region 412 423 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101677
SMART Domains Protein: ENSMUSP00000099200
Gene: ENSMUSG00000004631

DomainStartEndE-ValueType
CADG 49 157 1.86e-10 SMART
low complexity region 421 432 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115577
AA Change: K70E

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000111240
Gene: ENSMUSG00000004631
AA Change: K70E

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
CADG 85 193 1.86e-10 SMART
low complexity region 457 468 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115579
SMART Domains Protein: ENSMUSP00000111242
Gene: ENSMUSG00000004631

DomainStartEndE-ValueType
CADG 49 157 1.86e-10 SMART
low complexity region 421 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123907
SMART Domains Protein: ENSMUSP00000120910
Gene: ENSMUSG00000004631

DomainStartEndE-ValueType
CADG 32 140 1.86e-10 SMART
low complexity region 395 406 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126151
SMART Domains Protein: ENSMUSP00000120718
Gene: ENSMUSG00000004631

DomainStartEndE-ValueType
CADG 26 134 1.86e-10 SMART
low complexity region 389 400 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128109
Predicted Effect probably benign
Transcript: ENSMUST00000133306
SMART Domains Protein: ENSMUSP00000121964
Gene: ENSMUSG00000004631

DomainStartEndE-ValueType
CADG 26 134 1.86e-10 SMART
low complexity region 398 409 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153284
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the epsilon member of the sarcoglycan family. Sarcoglycans are transmembrane proteins that are components of the dystrophin-glycoprotein complex, which link the actin cytoskeleton to the extracellular matrix. Unlike other family members which are predominantly expressed in striated muscle, the epsilon sarcoglycan is more broadly expressed. Mutations in this gene are associated with myoclonus-dystonia syndrome. This gene is imprinted, with preferential expression from the paternal allele. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A pseudogene associated with this gene is located on chromosome 2. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous or heterozygous for a knock-out allele display significantly increased myoclonus and deficits in motor coordination and balance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 G T 4: 133,064,724 C1092F possibly damaging Het
Aplf T C 6: 87,646,248 E304G possibly damaging Het
Atp12a A G 14: 56,378,422 D547G probably benign Het
B3gat2 T C 1: 23,815,261 L212P probably damaging Het
Babam2 G T 5: 32,001,362 A219S probably damaging Het
Ccdc18 A C 5: 108,174,887 S618R possibly damaging Het
Ces2c G A 8: 104,852,116 G342D probably damaging Het
Cfap57 A C 4: 118,595,759 D582E probably benign Het
Cisd2 T C 3: 135,408,866 N115D possibly damaging Het
Cyp17a1 A G 19: 46,672,720 F42L probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fam234a T C 17: 26,218,237 D156G probably benign Het
Fer1l6 T A 15: 58,641,918 I1554K probably benign Het
Fv1 A G 4: 147,870,017 T347A possibly damaging Het
Gm5134 T A 10: 75,995,809 C361S probably benign Het
Gm5415 T A 1: 32,545,491 D446V probably damaging Het
Grin3a T C 4: 49,792,516 I406V probably benign Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Ifna13 A C 4: 88,643,845 L181V possibly damaging Het
Irx4 A G 13: 73,266,594 probably null Het
Kcna3 T A 3: 107,037,606 M395K probably damaging Het
Kcnma1 A T 14: 23,509,889 V347D probably damaging Het
Kng2 A T 16: 23,003,948 V218E probably benign Het
Krt36 G A 11: 100,104,472 Q167* probably null Het
Lama2 T C 10: 27,023,329 D2457G possibly damaging Het
Ldah G A 12: 8,268,599 probably null Het
Lhfpl3 G T 5: 22,746,244 A18S probably benign Het
Lrrk1 A G 7: 66,307,103 probably null Het
Ltv1 T C 10: 13,179,701 Y352C probably damaging Het
Lyst G T 13: 13,658,754 M1720I probably benign Het
Mkx A T 18: 6,937,059 probably null Het
Myo18a A G 11: 77,820,809 H626R probably damaging Het
Nop9 A C 14: 55,753,741 Q618H probably damaging Het
Olfr1255 T C 2: 89,816,562 S73P probably damaging Het
Olfr25 T C 9: 38,330,282 S232P probably benign Het
Olfr358 T C 2: 37,005,542 Q24R probably damaging Het
Olfr850 A G 9: 19,478,041 S67P probably damaging Het
Otog C A 7: 46,252,040 Q388K probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Oxct2b T G 4: 123,117,715 V476G probably damaging Het
Parp10 T C 15: 76,242,002 T329A probably benign Het
Pcdhga5 T C 18: 37,696,682 S728P probably benign Het
Piezo1 G T 8: 122,494,932 H574Q probably damaging Het
Pnpla1 G A 17: 28,881,368 G403E probably benign Het
Pqlc3 T C 12: 16,997,703 D76G probably damaging Het
Preb C A 5: 30,958,051 V255F probably damaging Het
Prmt9 A G 8: 77,577,463 N725S probably damaging Het
Ric1 A T 19: 29,567,365 probably null Het
Serinc3 G C 2: 163,630,976 L245V probably benign Het
Simc1 T G 13: 54,539,724 V102G probably damaging Het
Smyd2 A G 1: 189,883,852 Y362H probably damaging Het
Sptbn1 G T 11: 30,100,660 H2310N probably benign Het
Syne1 T C 10: 5,234,652 Y4077C probably damaging Het
Syne2 C A 12: 75,890,381 A251E probably damaging Het
Taok1 A T 11: 77,573,783 L159Q probably damaging Het
Timeless T C 10: 128,250,724 L1043P probably damaging Het
Tmprss3 T C 17: 31,186,562 E352G probably damaging Het
Trav6-4 A T 14: 53,454,582 T46S probably benign Het
Ubiad1 A T 4: 148,436,626 Y180* probably null Het
Usp47 A G 7: 112,087,056 E627G probably damaging Het
Vmn2r124 A G 17: 18,062,883 T280A probably benign Het
Other mutations in Sgce
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Sgce APN 6 4689750 missense probably damaging 1.00
IGL01399:Sgce APN 6 4746997 missense probably damaging 1.00
IGL01796:Sgce APN 6 4711326 missense probably damaging 1.00
IGL02403:Sgce APN 6 4694059 missense probably damaging 1.00
IGL02421:Sgce APN 6 4694187 splice site probably benign
IGL02547:Sgce APN 6 4711301 splice site probably benign
IGL02585:Sgce APN 6 4711388 splice site probably benign
IGL03355:Sgce APN 6 4689738 missense probably damaging 1.00
IGL03374:Sgce APN 6 4689718 nonsense probably null
PIT4445001:Sgce UTSW 6 4689654 missense possibly damaging 0.85
R0345:Sgce UTSW 6 4718019 missense probably damaging 1.00
R0611:Sgce UTSW 6 4689621 missense probably damaging 1.00
R0719:Sgce UTSW 6 4689753 missense probably damaging 1.00
R1162:Sgce UTSW 6 4691419 splice site probably benign
R1630:Sgce UTSW 6 4719476 missense probably damaging 0.98
R1694:Sgce UTSW 6 4689709 missense probably damaging 1.00
R1759:Sgce UTSW 6 4689765 missense probably damaging 1.00
R1897:Sgce UTSW 6 4691511 missense probably benign 0.00
R2231:Sgce UTSW 6 4730066 missense probably benign 0.44
R3429:Sgce UTSW 6 4730008 missense probably benign 0.01
R4011:Sgce UTSW 6 4691563 nonsense probably null
R4426:Sgce UTSW 6 4691459 missense probably damaging 0.97
R4427:Sgce UTSW 6 4691459 missense probably damaging 0.97
R4651:Sgce UTSW 6 4689560 intron probably benign
R4652:Sgce UTSW 6 4689560 intron probably benign
R4921:Sgce UTSW 6 4694153 missense probably damaging 1.00
R4974:Sgce UTSW 6 4689630 missense probably benign 0.00
R6898:Sgce UTSW 6 4689666 missense probably damaging 1.00
R7317:Sgce UTSW 6 4691615 missense probably benign 0.00
R7347:Sgce UTSW 6 4694106 missense probably damaging 1.00
R7512:Sgce UTSW 6 4707192 missense possibly damaging 0.75
X0026:Sgce UTSW 6 4689638 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- AGTAAGCACACGTGAATGGTTC -3'
(R):5'- CTGAGAAGATGTAGTCTGAGCC -3'

Sequencing Primer
(F):5'- GCACACGTGAATGGTTCTATAAGTG -3'
(R):5'- GTCTGAGCCAAGTTAACAGTAAC -3'
Posted On2018-03-15