Incidental Mutation 'R6271:Usp47'
ID507333
Institutional Source Beutler Lab
Gene Symbol Usp47
Ensembl Gene ENSMUSG00000059263
Gene Nameubiquitin specific peptidase 47
SynonymsA630020C16Rik, 4930502N04Rik
MMRRC Submission 044379-MU
Accession Numbers

Genbank: NM_133758; MGI: 1922246

Is this an essential gene? Possibly essential (E-score: 0.526) question?
Stock #R6271 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location112023504-112111661 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112087056 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 627 (E627G)
Ref Sequence ENSEMBL: ENSMUSP00000151051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106653] [ENSMUST00000210309] [ENSMUST00000215510]
Predicted Effect probably damaging
Transcript: ENSMUST00000106653
AA Change: E607G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102264
Gene: ENSMUSG00000059263
AA Change: E607G

DomainStartEndE-ValueType
Pfam:UCH 167 541 1.2e-50 PFAM
Pfam:UCH_1 168 507 5.1e-31 PFAM
coiled coil region 554 586 N/A INTRINSIC
low complexity region 859 880 N/A INTRINSIC
low complexity region 934 950 N/A INTRINSIC
Pfam:Ubiquitin_2 1026 1095 1.9e-3 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000210309
AA Change: E627G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210526
Predicted Effect probably damaging
Transcript: ENSMUST00000215510
AA Change: E627G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mouse embryonic fibroblasts from mice homozygous for a gene trap allele exhibit increased sensitivity to UV irradiation. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 G T 4: 133,064,724 C1092F possibly damaging Het
Aplf T C 6: 87,646,248 E304G possibly damaging Het
Atp12a A G 14: 56,378,422 D547G probably benign Het
B3gat2 T C 1: 23,815,261 L212P probably damaging Het
Babam2 G T 5: 32,001,362 A219S probably damaging Het
Ccdc18 A C 5: 108,174,887 S618R possibly damaging Het
Ces2c G A 8: 104,852,116 G342D probably damaging Het
Cfap57 A C 4: 118,595,759 D582E probably benign Het
Cisd2 T C 3: 135,408,866 N115D possibly damaging Het
Cyp17a1 A G 19: 46,672,720 F42L probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fam234a T C 17: 26,218,237 D156G probably benign Het
Fer1l6 T A 15: 58,641,918 I1554K probably benign Het
Fv1 A G 4: 147,870,017 T347A possibly damaging Het
Gm5134 T A 10: 75,995,809 C361S probably benign Het
Gm5415 T A 1: 32,545,491 D446V probably damaging Het
Grin3a T C 4: 49,792,516 I406V probably benign Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Ifna13 A C 4: 88,643,845 L181V possibly damaging Het
Irx4 A G 13: 73,266,594 probably null Het
Kcna3 T A 3: 107,037,606 M395K probably damaging Het
Kcnma1 A T 14: 23,509,889 V347D probably damaging Het
Kng2 A T 16: 23,003,948 V218E probably benign Het
Krt36 G A 11: 100,104,472 Q167* probably null Het
Lama2 T C 10: 27,023,329 D2457G possibly damaging Het
Ldah G A 12: 8,268,599 probably null Het
Lhfpl3 G T 5: 22,746,244 A18S probably benign Het
Lrrk1 A G 7: 66,307,103 probably null Het
Ltv1 T C 10: 13,179,701 Y352C probably damaging Het
Lyst G T 13: 13,658,754 M1720I probably benign Het
Mkx A T 18: 6,937,059 probably null Het
Myo18a A G 11: 77,820,809 H626R probably damaging Het
Nop9 A C 14: 55,753,741 Q618H probably damaging Het
Olfr1255 T C 2: 89,816,562 S73P probably damaging Het
Olfr25 T C 9: 38,330,282 S232P probably benign Het
Olfr358 T C 2: 37,005,542 Q24R probably damaging Het
Olfr850 A G 9: 19,478,041 S67P probably damaging Het
Otog C A 7: 46,252,040 Q388K probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Oxct2b T G 4: 123,117,715 V476G probably damaging Het
Parp10 T C 15: 76,242,002 T329A probably benign Het
Pcdhga5 T C 18: 37,696,682 S728P probably benign Het
Piezo1 G T 8: 122,494,932 H574Q probably damaging Het
Pnpla1 G A 17: 28,881,368 G403E probably benign Het
Pqlc3 T C 12: 16,997,703 D76G probably damaging Het
Preb C A 5: 30,958,051 V255F probably damaging Het
Prmt9 A G 8: 77,577,463 N725S probably damaging Het
Ric1 A T 19: 29,567,365 probably null Het
Serinc3 G C 2: 163,630,976 L245V probably benign Het
Sgce T C 6: 4,730,015 K70E possibly damaging Het
Simc1 T G 13: 54,539,724 V102G probably damaging Het
Smyd2 A G 1: 189,883,852 Y362H probably damaging Het
Sptbn1 G T 11: 30,100,660 H2310N probably benign Het
Syne1 T C 10: 5,234,652 Y4077C probably damaging Het
Syne2 C A 12: 75,890,381 A251E probably damaging Het
Taok1 A T 11: 77,573,783 L159Q probably damaging Het
Timeless T C 10: 128,250,724 L1043P probably damaging Het
Tmprss3 T C 17: 31,186,562 E352G probably damaging Het
Trav6-4 A T 14: 53,454,582 T46S probably benign Het
Ubiad1 A T 4: 148,436,626 Y180* probably null Het
Vmn2r124 A G 17: 18,062,883 T280A probably benign Het
Other mutations in Usp47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Usp47 APN 7 112074783 missense probably benign 0.00
IGL00574:Usp47 APN 7 112063335 missense probably damaging 1.00
IGL00975:Usp47 APN 7 112093370 missense probably damaging 1.00
IGL01289:Usp47 APN 7 112063358 missense probably damaging 1.00
IGL01419:Usp47 APN 7 112087911 missense possibly damaging 0.94
IGL01645:Usp47 APN 7 112054862 missense probably damaging 0.96
IGL01871:Usp47 APN 7 112077786 splice site probably benign
IGL02066:Usp47 APN 7 112064397 missense probably damaging 1.00
IGL02122:Usp47 APN 7 112106908 missense probably damaging 0.97
IGL02153:Usp47 APN 7 112104049 missense probably benign 0.00
IGL02550:Usp47 APN 7 112104354 missense probably damaging 1.00
IGL02710:Usp47 APN 7 112092925 missense probably benign 0.01
IGL02756:Usp47 APN 7 112093063 missense possibly damaging 0.76
IGL03093:Usp47 APN 7 112089620 missense probably damaging 1.00
IGL03398:Usp47 APN 7 112074503 missense probably damaging 1.00
0152:Usp47 UTSW 7 112056577 missense probably damaging 0.96
PIT4142001:Usp47 UTSW 7 112104341 splice site probably benign
R0110:Usp47 UTSW 7 112056580 missense possibly damaging 0.88
R0381:Usp47 UTSW 7 112063393 critical splice donor site probably null
R0450:Usp47 UTSW 7 112056580 missense possibly damaging 0.88
R0634:Usp47 UTSW 7 112108655 missense probably damaging 1.00
R0881:Usp47 UTSW 7 112091436 missense possibly damaging 0.51
R1178:Usp47 UTSW 7 112109998 missense possibly damaging 0.68
R1447:Usp47 UTSW 7 112074568 critical splice donor site probably null
R1640:Usp47 UTSW 7 112083127 missense probably damaging 0.99
R1727:Usp47 UTSW 7 112086100 missense probably damaging 0.96
R1866:Usp47 UTSW 7 112101870 missense possibly damaging 0.93
R1876:Usp47 UTSW 7 112054920 missense probably damaging 0.99
R1953:Usp47 UTSW 7 112092876 missense probably benign 0.26
R2117:Usp47 UTSW 7 112067236 critical splice donor site probably null
R2176:Usp47 UTSW 7 112092727 missense probably benign 0.00
R2187:Usp47 UTSW 7 112067191 missense probably damaging 1.00
R2504:Usp47 UTSW 7 112104470 critical splice donor site probably null
R2902:Usp47 UTSW 7 112093451 missense probably damaging 1.00
R2922:Usp47 UTSW 7 112093198 missense probably damaging 1.00
R2939:Usp47 UTSW 7 112082536 missense probably damaging 1.00
R4065:Usp47 UTSW 7 112053416 missense probably benign 0.30
R4179:Usp47 UTSW 7 112087884 missense probably damaging 1.00
R4235:Usp47 UTSW 7 112110048 missense probably damaging 0.99
R4243:Usp47 UTSW 7 112108629 missense probably damaging 1.00
R4281:Usp47 UTSW 7 112109993 missense probably benign 0.03
R4360:Usp47 UTSW 7 112054932 missense probably damaging 1.00
R4604:Usp47 UTSW 7 112101831 missense probably damaging 1.00
R4857:Usp47 UTSW 7 112082552 missense probably damaging 1.00
R5133:Usp47 UTSW 7 112083882 missense probably damaging 1.00
R5179:Usp47 UTSW 7 112093432 missense probably damaging 1.00
R5322:Usp47 UTSW 7 112053269 missense probably damaging 0.99
R5445:Usp47 UTSW 7 112074721 missense probably damaging 1.00
R5465:Usp47 UTSW 7 112059002 missense probably damaging 1.00
R5699:Usp47 UTSW 7 112109997 missense probably benign 0.00
R5961:Usp47 UTSW 7 112053316 missense probably damaging 1.00
R6117:Usp47 UTSW 7 112087932 missense probably damaging 0.98
R7155:Usp47 UTSW 7 112087013 missense probably damaging 0.97
R7229:Usp47 UTSW 7 112092877 missense probably benign 0.04
R7285:Usp47 UTSW 7 112093108 missense probably benign 0.02
X0027:Usp47 UTSW 7 112087847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTCAATCAGTTACAAATACAGACAG -3'
(R):5'- GATTCAGAAGGCAGACTAGTTTTC -3'

Sequencing Primer
(F):5'- TGCCAAAGGATTCAGCTG -3'
(R):5'- GGCAGACTAGTTTTCAAAATCAACTG -3'
Posted On2018-03-15