Incidental Mutation 'R6271:Lama2'
ID507342
Institutional Source Beutler Lab
Gene Symbol Lama2
Ensembl Gene ENSMUSG00000019899
Gene Namelaminin, alpha 2
Synonymsmerosin, mer
MMRRC Submission 044379-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.335) question?
Stock #R6271 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location26980036-27619758 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27023329 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 2457 (D2457G)
Ref Sequence ENSEMBL: ENSMUSP00000090304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092639]
PDB Structure
LAMININ ALPHA 2 CHAIN LG4-5 DOMAIN PAIR [X-RAY DIFFRACTION]
LAMININ ALPHA 2 CHAIN LG4-5 DOMAIN PAIR, CA1 SITE MUTANT [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE FIFTH LAMININ G-LIKE MODULE OF THE MOUSE LAMININ ALPHA2 CHAIN [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE LG1-3 REGION OF THE LAMININ ALPHA2 CHAIN [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092639
AA Change: D2457G

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000090304
Gene: ENSMUSG00000019899
AA Change: D2457G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LamNT 29 281 5.35e-129 SMART
EGF_Lam 283 337 2.11e-4 SMART
EGF_Lam 340 407 1.59e-8 SMART
EGF_Lam 410 462 5.44e-7 SMART
EGF_Lam 465 511 9.05e-4 SMART
LamB 574 706 2.26e-44 SMART
Pfam:Laminin_EGF 715 745 2.8e-4 PFAM
EGF_Lam 753 800 4.03e-10 SMART
EGF_Lam 803 858 3.01e-9 SMART
EGF_Lam 861 911 1.35e-11 SMART
EGF_Lam 914 960 7.23e-12 SMART
EGF_Lam 963 1007 5.87e-12 SMART
EGF_Lam 1010 1053 1.28e-12 SMART
EGF_Lam 1056 1099 2.37e-7 SMART
EGF_Lam 1102 1159 3.22e-9 SMART
LamB 1225 1360 1.95e-57 SMART
EGF_like 1364 1413 8.13e-1 SMART
EGF_Lam 1416 1462 5.48e-12 SMART
EGF_Lam 1465 1520 1.27e-7 SMART
EGF_Lam 1523 1567 2.4e-8 SMART
Pfam:Laminin_I 1584 1849 2e-92 PFAM
Blast:MA 1881 2113 1e-112 BLAST
LamG 2162 2307 1.28e-25 SMART
LamG 2356 2500 2.2e-33 SMART
LamG 2542 2688 3.31e-28 SMART
low complexity region 2725 2741 N/A INTRINSIC
LamG 2781 2914 2.25e-39 SMART
LamG 2956 3092 1.53e-32 SMART
Predicted Effect unknown
Transcript: ENSMUST00000219763
AA Change: D469G
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminin, an extracellular protein, is a major component of the basement membrane. It is thought to mediate the attachment, migration, and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components. It is composed of three subunits, alpha, beta, and gamma, which are bound to each other by disulfide bonds into a cross-shaped molecule. This gene encodes the alpha 2 chain, which constitutes one of the subunits of laminin 2 (merosin) and laminin 4 (s-merosin). Mutations in this gene have been identified as the cause of congenital merosin-deficient muscular dystrophy. Two transcript variants encoding different proteins have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted and spontaneous mutations exhibit progressive growth retardation, ataxia, muscle atrophy and degeneration, infertility, and premature lethality. Muscle fiber degeneration is evident as early as the first week of life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 G T 4: 133,064,724 C1092F possibly damaging Het
Aplf T C 6: 87,646,248 E304G possibly damaging Het
Atp12a A G 14: 56,378,422 D547G probably benign Het
B3gat2 T C 1: 23,815,261 L212P probably damaging Het
Babam2 G T 5: 32,001,362 A219S probably damaging Het
Ccdc18 A C 5: 108,174,887 S618R possibly damaging Het
Ces2c G A 8: 104,852,116 G342D probably damaging Het
Cfap57 A C 4: 118,595,759 D582E probably benign Het
Cisd2 T C 3: 135,408,866 N115D possibly damaging Het
Cyp17a1 A G 19: 46,672,720 F42L probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fam234a T C 17: 26,218,237 D156G probably benign Het
Fer1l6 T A 15: 58,641,918 I1554K probably benign Het
Fv1 A G 4: 147,870,017 T347A possibly damaging Het
Gm5134 T A 10: 75,995,809 C361S probably benign Het
Gm5415 T A 1: 32,545,491 D446V probably damaging Het
Grin3a T C 4: 49,792,516 I406V probably benign Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Ifna13 A C 4: 88,643,845 L181V possibly damaging Het
Irx4 A G 13: 73,266,594 probably null Het
Kcna3 T A 3: 107,037,606 M395K probably damaging Het
Kcnma1 A T 14: 23,509,889 V347D probably damaging Het
Kng2 A T 16: 23,003,948 V218E probably benign Het
Krt36 G A 11: 100,104,472 Q167* probably null Het
Ldah G A 12: 8,268,599 probably null Het
Lhfpl3 G T 5: 22,746,244 A18S probably benign Het
Lrrk1 A G 7: 66,307,103 probably null Het
Ltv1 T C 10: 13,179,701 Y352C probably damaging Het
Lyst G T 13: 13,658,754 M1720I probably benign Het
Mkx A T 18: 6,937,059 probably null Het
Myo18a A G 11: 77,820,809 H626R probably damaging Het
Nop9 A C 14: 55,753,741 Q618H probably damaging Het
Olfr1255 T C 2: 89,816,562 S73P probably damaging Het
Olfr25 T C 9: 38,330,282 S232P probably benign Het
Olfr358 T C 2: 37,005,542 Q24R probably damaging Het
Olfr850 A G 9: 19,478,041 S67P probably damaging Het
Otog C A 7: 46,252,040 Q388K probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Oxct2b T G 4: 123,117,715 V476G probably damaging Het
Parp10 T C 15: 76,242,002 T329A probably benign Het
Pcdhga5 T C 18: 37,696,682 S728P probably benign Het
Piezo1 G T 8: 122,494,932 H574Q probably damaging Het
Pnpla1 G A 17: 28,881,368 G403E probably benign Het
Pqlc3 T C 12: 16,997,703 D76G probably damaging Het
Preb C A 5: 30,958,051 V255F probably damaging Het
Prmt9 A G 8: 77,577,463 N725S probably damaging Het
Ric1 A T 19: 29,567,365 probably null Het
Serinc3 G C 2: 163,630,976 L245V probably benign Het
Sgce T C 6: 4,730,015 K70E possibly damaging Het
Simc1 T G 13: 54,539,724 V102G probably damaging Het
Smyd2 A G 1: 189,883,852 Y362H probably damaging Het
Sptbn1 G T 11: 30,100,660 H2310N probably benign Het
Syne1 T C 10: 5,234,652 Y4077C probably damaging Het
Syne2 C A 12: 75,890,381 A251E probably damaging Het
Taok1 A T 11: 77,573,783 L159Q probably damaging Het
Timeless T C 10: 128,250,724 L1043P probably damaging Het
Tmprss3 T C 17: 31,186,562 E352G probably damaging Het
Trav6-4 A T 14: 53,454,582 T46S probably benign Het
Ubiad1 A T 4: 148,436,626 Y180* probably null Het
Usp47 A G 7: 112,087,056 E627G probably damaging Het
Vmn2r124 A G 17: 18,062,883 T280A probably benign Het
Other mutations in Lama2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Lama2 APN 10 27188265 missense probably benign 0.01
IGL00467:Lama2 APN 10 27467197 splice site probably benign
IGL00470:Lama2 APN 10 27243742 missense probably benign 0.22
IGL00517:Lama2 APN 10 27197330 missense probably benign 0.01
IGL00541:Lama2 APN 10 27188306 missense probably benign 0.14
IGL00931:Lama2 APN 10 27006776 missense possibly damaging 0.92
IGL00951:Lama2 APN 10 27030285 missense probably benign 0.03
IGL00988:Lama2 APN 10 27369015 nonsense probably null
IGL01098:Lama2 APN 10 27031112 missense possibly damaging 0.66
IGL01152:Lama2 APN 10 27208429 missense probably benign 0.00
IGL01293:Lama2 APN 10 27231636 missense probably benign 0.38
IGL01338:Lama2 APN 10 27188272 missense probably benign 0.13
IGL01609:Lama2 APN 10 27344421 missense probably benign 0.03
IGL01643:Lama2 APN 10 27070372 splice site probably benign
IGL01675:Lama2 APN 10 27188054 missense possibly damaging 0.77
IGL01681:Lama2 APN 10 27265045 missense probably benign 0.33
IGL01694:Lama2 APN 10 27006742 missense possibly damaging 0.75
IGL01705:Lama2 APN 10 27189274 splice site probably benign
IGL01885:Lama2 APN 10 27105139 nonsense probably null
IGL01935:Lama2 APN 10 27422604 missense probably damaging 0.98
IGL01994:Lama2 APN 10 27467203 critical splice donor site probably null
IGL02041:Lama2 APN 10 26984326 missense probably damaging 1.00
IGL02067:Lama2 APN 10 27176796 missense probably benign 0.02
IGL02097:Lama2 APN 10 27138960 missense probably benign 0.09
IGL02179:Lama2 APN 10 27070364 missense probably benign 0.01
IGL02268:Lama2 APN 10 27001116 splice site probably benign
IGL02302:Lama2 APN 10 27212043 missense probably benign 0.06
IGL02363:Lama2 APN 10 27366066 missense probably damaging 1.00
IGL02378:Lama2 APN 10 27043656 missense probably damaging 0.99
IGL02642:Lama2 APN 10 27467273 missense probably damaging 1.00
IGL02676:Lama2 APN 10 27118493 missense probably benign 0.00
IGL02695:Lama2 APN 10 27000775 missense probably benign
IGL02735:Lama2 APN 10 27104128 missense probably damaging 1.00
IGL02794:Lama2 APN 10 27041231 missense possibly damaging 0.73
IGL02823:Lama2 APN 10 27001145 missense probably damaging 1.00
IGL02869:Lama2 APN 10 27015538 missense probably damaging 0.99
IGL02942:Lama2 APN 10 27041220 missense probably damaging 1.00
IGL03201:Lama2 APN 10 27344570 nonsense probably null
IGL03268:Lama2 APN 10 27422653 missense probably damaging 1.00
IGL03288:Lama2 APN 10 27369051 missense probably damaging 1.00
IGL03380:Lama2 APN 10 27050265 missense probably damaging 1.00
IGL03407:Lama2 APN 10 27347021 missense probably damaging 1.00
cowboy UTSW 10 27043643 frame shift probably null
petri UTSW 10 26993398 splice site probably null
PIT4362001:Lama2 UTSW 10 27369136 missense probably damaging 1.00
PIT4382001:Lama2 UTSW 10 27204905 missense probably damaging 1.00
PIT4431001:Lama2 UTSW 10 27101430 missense probably damaging 1.00
R0038:Lama2 UTSW 10 26986797 missense probably benign 0.02
R0038:Lama2 UTSW 10 26986797 missense probably benign 0.02
R0114:Lama2 UTSW 10 26993068 nonsense probably null
R0142:Lama2 UTSW 10 27187845 missense probably benign
R0313:Lama2 UTSW 10 26993398 splice site probably null
R0376:Lama2 UTSW 10 27015546 missense possibly damaging 0.68
R0412:Lama2 UTSW 10 27190625 missense possibly damaging 0.58
R0472:Lama2 UTSW 10 26990867 missense probably damaging 1.00
R0607:Lama2 UTSW 10 27189131 missense probably benign 0.34
R0648:Lama2 UTSW 10 26989376 missense probably benign 0.00
R0667:Lama2 UTSW 10 27344410 splice site probably null
R0760:Lama2 UTSW 10 27044433 critical splice donor site probably null
R1240:Lama2 UTSW 10 27041124 missense probably damaging 1.00
R1385:Lama2 UTSW 10 27224043 missense probably benign 0.11
R1433:Lama2 UTSW 10 27187754 missense probably damaging 1.00
R1434:Lama2 UTSW 10 27208370 missense probably damaging 1.00
R1574:Lama2 UTSW 10 27324754 missense possibly damaging 0.65
R1574:Lama2 UTSW 10 27324754 missense possibly damaging 0.65
R1645:Lama2 UTSW 10 27368985 missense probably damaging 1.00
R1702:Lama2 UTSW 10 27190529 missense probably benign
R1703:Lama2 UTSW 10 27266671 missense probably damaging 1.00
R1769:Lama2 UTSW 10 27208406 missense probably damaging 1.00
R1769:Lama2 UTSW 10 27208407 missense probably benign
R1846:Lama2 UTSW 10 27212096 missense probably damaging 1.00
R1859:Lama2 UTSW 10 27031082 missense possibly damaging 0.51
R1871:Lama2 UTSW 10 26984494 missense probably damaging 1.00
R1903:Lama2 UTSW 10 27188399 missense probably damaging 1.00
R1906:Lama2 UTSW 10 27056527 critical splice donor site probably null
R1958:Lama2 UTSW 10 26981598 missense probably damaging 0.97
R1959:Lama2 UTSW 10 27422618 missense probably damaging 1.00
R1977:Lama2 UTSW 10 26990800 splice site probably null
R2063:Lama2 UTSW 10 27164926 missense probably damaging 1.00
R2079:Lama2 UTSW 10 27369053 missense probably damaging 0.99
R2085:Lama2 UTSW 10 27204841 nonsense probably null
R2125:Lama2 UTSW 10 27044453 nonsense probably null
R2140:Lama2 UTSW 10 27054694 splice site probably null
R2219:Lama2 UTSW 10 27043569 missense probably damaging 0.99
R2259:Lama2 UTSW 10 27031127 missense probably benign 0.00
R2265:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2266:Lama2 UTSW 10 26986797 missense probably benign 0.02
R2267:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2268:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2269:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2862:Lama2 UTSW 10 27422612 nonsense probably null
R2912:Lama2 UTSW 10 27000803 missense probably benign
R2999:Lama2 UTSW 10 26989421 missense probably benign 0.18
R3034:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3081:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3107:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3109:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3436:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3437:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3706:Lama2 UTSW 10 27138996 missense probably damaging 1.00
R3780:Lama2 UTSW 10 27459339 missense probably damaging 1.00
R3807:Lama2 UTSW 10 27190665 frame shift probably null
R3919:Lama2 UTSW 10 27118505 missense probably damaging 1.00
R4014:Lama2 UTSW 10 26984376 missense probably damaging 1.00
R4131:Lama2 UTSW 10 27041174 missense probably benign 0.00
R4190:Lama2 UTSW 10 27266664 missense probably damaging 0.96
R4273:Lama2 UTSW 10 27347054 missense probably damaging 1.00
R4358:Lama2 UTSW 10 26984493 missense probably damaging 1.00
R4407:Lama2 UTSW 10 27212128 small deletion probably benign
R4415:Lama2 UTSW 10 26989344 nonsense probably null
R4426:Lama2 UTSW 10 27422558 missense probably damaging 1.00
R4590:Lama2 UTSW 10 26989414 missense probably benign 0.00
R4615:Lama2 UTSW 10 26981524 missense probably damaging 0.99
R4736:Lama2 UTSW 10 27204929 missense probably damaging 1.00
R4754:Lama2 UTSW 10 27118531 missense possibly damaging 0.58
R4791:Lama2 UTSW 10 27467271 missense probably damaging 1.00
R4834:Lama2 UTSW 10 27006749 missense probably benign 0.30
R4856:Lama2 UTSW 10 27043643 frame shift probably null
R4858:Lama2 UTSW 10 27043643 frame shift probably null
R4859:Lama2 UTSW 10 27043643 frame shift probably null
R4897:Lama2 UTSW 10 27043643 frame shift probably null
R4898:Lama2 UTSW 10 27043643 frame shift probably null
R4899:Lama2 UTSW 10 27043643 frame shift probably null
R4907:Lama2 UTSW 10 27164946 missense probably benign 0.11
R4911:Lama2 UTSW 10 27138927 missense probably damaging 1.00
R4924:Lama2 UTSW 10 27369141 missense probably damaging 0.98
R5023:Lama2 UTSW 10 27190504 missense probably damaging 0.97
R5057:Lama2 UTSW 10 27164986 missense probably damaging 1.00
R5070:Lama2 UTSW 10 27350251 critical splice donor site probably null
R5116:Lama2 UTSW 10 27118560 missense probably benign 0.08
R5177:Lama2 UTSW 10 27190703 missense possibly damaging 0.94
R5198:Lama2 UTSW 10 27347003 missense probably damaging 0.96
R5289:Lama2 UTSW 10 27212073 nonsense probably null
R5327:Lama2 UTSW 10 27138946 missense probably benign
R5424:Lama2 UTSW 10 26984396 missense probably damaging 1.00
R5469:Lama2 UTSW 10 27041189 missense possibly damaging 0.92
R5620:Lama2 UTSW 10 26990880 missense probably damaging 0.99
R5667:Lama2 UTSW 10 27190544 missense probably damaging 1.00
R5671:Lama2 UTSW 10 27190544 missense probably damaging 1.00
R5815:Lama2 UTSW 10 26986851 missense probably damaging 1.00
R5917:Lama2 UTSW 10 27190697 missense probably damaging 1.00
R5935:Lama2 UTSW 10 27015498 missense probably benign
R5976:Lama2 UTSW 10 27190676 missense probably benign 0.00
R5979:Lama2 UTSW 10 27235732 missense probably damaging 0.99
R6004:Lama2 UTSW 10 27235785 missense probably benign 0.01
R6180:Lama2 UTSW 10 26981499 missense probably benign 0.03
R6198:Lama2 UTSW 10 27188022 missense probably damaging 1.00
R6257:Lama2 UTSW 10 26986899 missense possibly damaging 0.85
R6322:Lama2 UTSW 10 27190547 missense probably damaging 0.96
R6354:Lama2 UTSW 10 27212068 missense probably damaging 1.00
R6431:Lama2 UTSW 10 27053031 missense possibly damaging 0.50
R6499:Lama2 UTSW 10 27031158 missense probably damaging 1.00
R6535:Lama2 UTSW 10 27104131 missense probably damaging 1.00
R6545:Lama2 UTSW 10 27176797 missense probably benign
R6636:Lama2 UTSW 10 27124568 missense probably benign 0.13
R6891:Lama2 UTSW 10 27328072 nonsense probably null
R6891:Lama2 UTSW 10 27328082 nonsense probably null
R6902:Lama2 UTSW 10 26981629 missense probably damaging 1.00
R6908:Lama2 UTSW 10 27031196 splice site probably null
R7168:Lama2 UTSW 10 27366152 critical splice acceptor site probably null
R7233:Lama2 UTSW 10 27231663 missense probably damaging 1.00
R7272:Lama2 UTSW 10 27124556 missense probably damaging 1.00
R7274:Lama2 UTSW 10 27119980 missense probably damaging 0.99
R7419:Lama2 UTSW 10 27266634 missense probably benign
R7423:Lama2 UTSW 10 27212226 missense probably benign 0.00
R7554:Lama2 UTSW 10 27155496 missense not run
R7569:Lama2 UTSW 10 27265050 missense not run
Predicted Primers PCR Primer
(F):5'- CTAGTGTTGTTCTTACATGCGAC -3'
(R):5'- TGCTGAGAGAACACCAGTGTC -3'

Sequencing Primer
(F):5'- CTTCACAATGCTAGTGACCA -3'
(R):5'- GCTGAGAGAACACCAGTGTCTATTTG -3'
Posted On2018-03-15