Incidental Mutation 'R6271:Mkx'
ID507368
Institutional Source Beutler Lab
Gene Symbol Mkx
Ensembl Gene ENSMUSG00000061013
Gene Namemohawk homeobox
Synonyms9430023B20Rik, Irxl1
MMRRC Submission 044379-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6271 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location6910459-7004780 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 6937059 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000078718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079788] [ENSMUST00000079788]
Predicted Effect probably null
Transcript: ENSMUST00000079788
SMART Domains Protein: ENSMUSP00000078718
Gene: ENSMUSG00000061013

DomainStartEndE-ValueType
HOX 71 135 5.01e-4 SMART
low complexity region 158 171 N/A INTRINSIC
low complexity region 252 263 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000079788
SMART Domains Protein: ENSMUSP00000078718
Gene: ENSMUSG00000061013

DomainStartEndE-ValueType
HOX 71 135 5.01e-4 SMART
low complexity region 158 171 N/A INTRINSIC
low complexity region 252 263 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176586
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188926
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an IRX family-related homeobox protein that may play a role in cell adhesion. Studies in mice suggest that this protein may be a regulator of tendon development. Two transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit thin, hypoplastic tendons with reduced tensile strength. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 G T 4: 133,064,724 C1092F possibly damaging Het
Aplf T C 6: 87,646,248 E304G possibly damaging Het
Atp12a A G 14: 56,378,422 D547G probably benign Het
B3gat2 T C 1: 23,815,261 L212P probably damaging Het
Babam2 G T 5: 32,001,362 A219S probably damaging Het
Ccdc18 A C 5: 108,174,887 S618R possibly damaging Het
Ces2c G A 8: 104,852,116 G342D probably damaging Het
Cfap57 A C 4: 118,595,759 D582E probably benign Het
Cisd2 T C 3: 135,408,866 N115D possibly damaging Het
Cyp17a1 A G 19: 46,672,720 F42L probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fam234a T C 17: 26,218,237 D156G probably benign Het
Fer1l6 T A 15: 58,641,918 I1554K probably benign Het
Fv1 A G 4: 147,870,017 T347A possibly damaging Het
Gm5134 T A 10: 75,995,809 C361S probably benign Het
Gm5415 T A 1: 32,545,491 D446V probably damaging Het
Grin3a T C 4: 49,792,516 I406V probably benign Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Ifna13 A C 4: 88,643,845 L181V possibly damaging Het
Irx4 A G 13: 73,266,594 probably null Het
Kcna3 T A 3: 107,037,606 M395K probably damaging Het
Kcnma1 A T 14: 23,509,889 V347D probably damaging Het
Kng2 A T 16: 23,003,948 V218E probably benign Het
Krt36 G A 11: 100,104,472 Q167* probably null Het
Lama2 T C 10: 27,023,329 D2457G possibly damaging Het
Ldah G A 12: 8,268,599 probably null Het
Lhfpl3 G T 5: 22,746,244 A18S probably benign Het
Lrrk1 A G 7: 66,307,103 probably null Het
Ltv1 T C 10: 13,179,701 Y352C probably damaging Het
Lyst G T 13: 13,658,754 M1720I probably benign Het
Myo18a A G 11: 77,820,809 H626R probably damaging Het
Nop9 A C 14: 55,753,741 Q618H probably damaging Het
Olfr1255 T C 2: 89,816,562 S73P probably damaging Het
Olfr25 T C 9: 38,330,282 S232P probably benign Het
Olfr358 T C 2: 37,005,542 Q24R probably damaging Het
Olfr850 A G 9: 19,478,041 S67P probably damaging Het
Otog C A 7: 46,252,040 Q388K probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Oxct2b T G 4: 123,117,715 V476G probably damaging Het
Parp10 T C 15: 76,242,002 T329A probably benign Het
Pcdhga5 T C 18: 37,696,682 S728P probably benign Het
Piezo1 G T 8: 122,494,932 H574Q probably damaging Het
Pnpla1 G A 17: 28,881,368 G403E probably benign Het
Pqlc3 T C 12: 16,997,703 D76G probably damaging Het
Preb C A 5: 30,958,051 V255F probably damaging Het
Prmt9 A G 8: 77,577,463 N725S probably damaging Het
Ric1 A T 19: 29,567,365 probably null Het
Serinc3 G C 2: 163,630,976 L245V probably benign Het
Sgce T C 6: 4,730,015 K70E possibly damaging Het
Simc1 T G 13: 54,539,724 V102G probably damaging Het
Smyd2 A G 1: 189,883,852 Y362H probably damaging Het
Sptbn1 G T 11: 30,100,660 H2310N probably benign Het
Syne1 T C 10: 5,234,652 Y4077C probably damaging Het
Syne2 C A 12: 75,890,381 A251E probably damaging Het
Taok1 A T 11: 77,573,783 L159Q probably damaging Het
Timeless T C 10: 128,250,724 L1043P probably damaging Het
Tmprss3 T C 17: 31,186,562 E352G probably damaging Het
Trav6-4 A T 14: 53,454,582 T46S probably benign Het
Ubiad1 A T 4: 148,436,626 Y180* probably null Het
Usp47 A G 7: 112,087,056 E627G probably damaging Het
Vmn2r124 A G 17: 18,062,883 T280A probably benign Het
Other mutations in Mkx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Mkx APN 18 6937192 missense probably benign
IGL02478:Mkx APN 18 7002418 missense probably damaging 0.99
IGL02676:Mkx APN 18 7000640 missense probably benign 0.08
IGL02806:Mkx APN 18 6937025 missense probably damaging 1.00
R0766:Mkx UTSW 18 6937192 missense probably benign 0.05
R1273:Mkx UTSW 18 7002460 missense probably benign
R1312:Mkx UTSW 18 6937192 missense probably benign 0.05
R1496:Mkx UTSW 18 6992330 nonsense probably null
R2083:Mkx UTSW 18 6992855 missense probably damaging 0.99
R2196:Mkx UTSW 18 7000675 missense probably damaging 0.99
R3013:Mkx UTSW 18 6936929 missense probably damaging 0.99
R4544:Mkx UTSW 18 7000651 missense probably damaging 1.00
R4646:Mkx UTSW 18 6992040 missense probably benign 0.43
R4798:Mkx UTSW 18 7002432 missense probably benign
R4887:Mkx UTSW 18 6992904 missense probably damaging 1.00
R4945:Mkx UTSW 18 7000657 missense possibly damaging 0.76
R6129:Mkx UTSW 18 6992888 missense probably damaging 0.98
R6267:Mkx UTSW 18 7000591 critical splice donor site probably null
R6296:Mkx UTSW 18 7000591 critical splice donor site probably null
R6569:Mkx UTSW 18 6992820 nonsense probably null
R7165:Mkx UTSW 18 7002525 missense probably damaging 0.97
R7365:Mkx UTSW 18 7000747 missense possibly damaging 0.85
Z1088:Mkx UTSW 18 6936975 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCCTGGCCACTCTAGAAG -3'
(R):5'- AGGCTTGGCTTCTTAGTAACC -3'

Sequencing Primer
(F):5'- TCTAGAAGCGCTGCACCAGTG -3'
(R):5'- CAGAGGACCTGCATTTGGTTCC -3'
Posted On2018-03-15