Incidental Mutation 'R6272:Mettl8'
ID507378
Institutional Source Beutler Lab
Gene Symbol Mettl8
Ensembl Gene ENSMUSG00000041975
Gene Namemethyltransferase like 8
SynonymsTIP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.880) question?
Stock #R6272 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location70964561-71055583 bp(-) (GRCm38)
Type of Mutationunclassified (2849 bp from exon)
DNA Base Change (assembly) T to C at 70976075 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000088359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090849] [ENSMUST00000100037] [ENSMUST00000112179] [ENSMUST00000112186] [ENSMUST00000121586] [ENSMUST00000148876] [ENSMUST00000149181]
Predicted Effect probably null
Transcript: ENSMUST00000090849
Predicted Effect probably damaging
Transcript: ENSMUST00000100037
AA Change: K183R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097615
Gene: ENSMUSG00000041975
AA Change: K183R

DomainStartEndE-ValueType
Pfam:Methyltransf_23 115 304 1.4e-14 PFAM
Pfam:Ubie_methyltran 126 265 1.4e-7 PFAM
Pfam:Methyltransf_31 137 304 5.6e-10 PFAM
Pfam:Methyltransf_26 140 251 4.2e-8 PFAM
Pfam:Methyltransf_25 143 246 5.3e-13 PFAM
Pfam:Methyltransf_12 144 248 1e-12 PFAM
Pfam:Methyltransf_11 144 250 7.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112179
SMART Domains Protein: ENSMUSP00000107800
Gene: ENSMUSG00000041975

DomainStartEndE-ValueType
low complexity region 190 206 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112186
AA Change: K230R

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107804
Gene: ENSMUSG00000041975
AA Change: K230R

DomainStartEndE-ValueType
Pfam:Methyltransf_23 158 349 5.1e-15 PFAM
Pfam:Ubie_methyltran 173 312 8.7e-8 PFAM
Pfam:Methyltransf_31 184 348 3.7e-9 PFAM
Pfam:Methyltransf_25 190 293 3.9e-13 PFAM
Pfam:Methyltransf_12 191 295 7e-13 PFAM
Pfam:Methyltransf_11 191 297 6.2e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121586
AA Change: K230R

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113642
Gene: ENSMUSG00000041975
AA Change: K230R

DomainStartEndE-ValueType
Pfam:Methyltransf_25 190 279 1.4e-6 PFAM
Pfam:Methyltransf_11 191 280 5.6e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124208
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124781
Predicted Effect probably benign
Transcript: ENSMUST00000140293
SMART Domains Protein: ENSMUSP00000118026
Gene: ENSMUSG00000041975

DomainStartEndE-ValueType
Pfam:Methyltransf_11 2 66 2.2e-8 PFAM
Pfam:Methyltransf_23 3 109 6.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000148876
AA Change: K230R

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115855
Gene: ENSMUSG00000041975
AA Change: K230R

DomainStartEndE-ValueType
Pfam:Methyltransf_25 190 281 1.9e-8 PFAM
Pfam:Methyltransf_11 191 280 2.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149181
SMART Domains Protein: ENSMUSP00000119863
Gene: ENSMUSG00000041975

DomainStartEndE-ValueType
SCOP:d1af7_2 107 137 7e-3 SMART
Meta Mutation Damage Score 0.166 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.3%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: This locus encodes a member of the methyltransferase family, and is involved in chromatin remodeling. Transcripts from this locus can be induced or inhibited by cell stretch and affect cell differentiation in the myogenic or adipogenic pathways. Multiple transcript variants encoding different isoforms have been found for this gene. Additional splice variants have been described in the literature but they meet nonsense-mediated decay (NMD) criteria and are likely to be degraded as soon as they are transcribed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced 3-methylcytidine (m3C) methyltransferases modification of mRNA. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 A T 5: 50,009,449 M187K possibly damaging Het
Adgrg3 A G 8: 95,036,261 I189V noncoding transcript Het
Ampd1 A G 3: 103,085,383 K147R possibly damaging Het
Apbb2 T C 5: 66,311,072 T561A probably damaging Het
Arfgef3 A T 10: 18,646,963 D438E probably benign Het
Atxn1 T A 13: 45,567,762 Q219L possibly damaging Het
AW551984 A T 9: 39,598,037 D269E probably benign Het
Cryab A G 9: 50,754,525 K72R possibly damaging Het
Dbn1 G A 13: 55,475,104 A522V probably benign Het
Dip2a A T 10: 76,286,407 *158R probably null Het
Edrf1 C T 7: 133,637,808 probably benign Het
Ern2 A T 7: 122,176,646 D408E probably benign Het
F830016B08Rik T C 18: 60,300,078 S78P probably damaging Het
Fah C A 7: 84,595,545 G137C probably damaging Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Foxd3 A G 4: 99,656,740 D39G probably damaging Het
Gm3854 C T 7: 6,353,845 P219L probably damaging Het
Gprin3 G A 6: 59,353,331 Q664* probably null Het
H2-Ob T C 17: 34,242,644 I119T probably benign Het
Hist1h3e A T 13: 23,562,226 V47E probably damaging Het
Hmgcll1 G A 9: 76,130,345 G174R probably damaging Het
Kbtbd11 T A 8: 15,029,118 C572* probably null Het
Kynu A T 2: 43,634,989 N315Y probably benign Het
Map1lc3b G A 8: 121,596,690 E100K probably benign Het
Matn2 T A 15: 34,355,607 Q33L possibly damaging Het
Neto1 A T 18: 86,494,815 N312Y probably damaging Het
Nhsl1 A G 10: 18,524,505 D493G probably benign Het
Nup210l A G 3: 90,170,024 E889G possibly damaging Het
Olfr1153 G A 2: 87,896,657 V153I probably benign Het
Olfr1383 C A 11: 49,524,126 S134R possibly damaging Het
Olfr1402 A G 3: 97,410,891 F97L probably benign Het
Olfr209 A C 16: 59,361,585 M211R possibly damaging Het
Olfr296-ps1 A G 7: 86,561,873 Y47C unknown Het
Olfr420 C T 1: 174,159,175 T134I probably benign Het
Olfr967 A T 9: 39,750,520 M45L probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Phc2 A G 4: 128,709,647 Y190C probably damaging Het
Platr25 T C 13: 62,672,997 T347A possibly damaging Het
Plec T C 15: 76,174,853 E3655G probably damaging Het
Plekhg3 A T 12: 76,576,845 Q954L probably benign Het
Pnpla1 G A 17: 28,881,368 G403E probably benign Het
Prdm4 G A 10: 85,907,830 T187I possibly damaging Het
Prg4 T C 1: 150,454,766 probably benign Het
Prpf18 G A 2: 4,633,447 R312W probably damaging Het
Rnf213 T A 11: 119,414,548 V535D probably damaging Het
Rtcb A T 10: 85,955,774 N39K probably damaging Het
Slc4a3 G A 1: 75,554,697 probably null Het
Szt2 A C 4: 118,374,290 probably benign Het
Tfap2e A T 4: 126,721,864 V259D probably damaging Het
Trav19 A G 14: 53,845,798 D110G probably damaging Het
Ttc17 A C 2: 94,358,755 C749W probably damaging Het
Ttc8 A G 12: 98,982,494 K490E possibly damaging Het
Ube4b A G 4: 149,387,133 S99P probably damaging Het
Ubqln3 C T 7: 104,142,178 R235H probably damaging Het
Vmn2r61 A T 7: 42,299,818 D554V probably damaging Het
Vmn2r70 A T 7: 85,558,986 V761E probably damaging Het
Vmn2r97 T C 17: 18,947,599 I705T possibly damaging Het
Wwox G A 8: 114,488,952 C155Y probably damaging Het
Zfp451 T C 1: 33,803,244 probably benign Het
Other mutations in Mettl8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00795:Mettl8 APN 2 70982090 missense probably damaging 1.00
IGL01370:Mettl8 APN 2 70982039 missense probably damaging 1.00
R1709:Mettl8 UTSW 2 70982151 missense probably benign 0.02
R1944:Mettl8 UTSW 2 70973279 missense probably damaging 1.00
R5107:Mettl8 UTSW 2 70965557 missense probably damaging 1.00
R5278:Mettl8 UTSW 2 70973297 missense probably damaging 1.00
R5629:Mettl8 UTSW 2 70965569 missense probably benign
R5864:Mettl8 UTSW 2 70982013 missense probably benign 0.10
R6402:Mettl8 UTSW 2 70966461 nonsense probably null
R6535:Mettl8 UTSW 2 70973389 missense possibly damaging 0.73
R7181:Mettl8 UTSW 2 70973362 missense possibly damaging 0.79
R7288:Mettl8 UTSW 2 70982038 missense probably benign 0.01
R7409:Mettl8 UTSW 2 70973343 missense probably damaging 1.00
X0062:Mettl8 UTSW 2 70981974 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TTGAGGTAGGTTAAACTTGGAGCC -3'
(R):5'- CAGGAGCTTCAAAGTTGGCC -3'

Sequencing Primer
(F):5'- AACTTGGAGCCCACTGATTG -3'
(R):5'- CTTCAAAGTTGGCCTGTAGTGACAAG -3'
Posted On2018-03-15