Incidental Mutation 'R6272:Phc2'
ID507386
Institutional Source Beutler Lab
Gene Symbol Phc2
Ensembl Gene ENSMUSG00000028796
Gene Namepolyhomeotic 2
SynonymsEdr2, D4Ertd810e, Mph2, D130050K19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6272 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location128654702-128752881 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128709647 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 190 (Y190C)
Ref Sequence ENSEMBL: ENSMUSP00000116333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030588] [ENSMUST00000106080] [ENSMUST00000136377]
Predicted Effect probably damaging
Transcript: ENSMUST00000030588
AA Change: Y190C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000030588
Gene: ENSMUSG00000028796
AA Change: Y190C

DomainStartEndE-ValueType
low complexity region 15 41 N/A INTRINSIC
low complexity region 74 119 N/A INTRINSIC
low complexity region 126 152 N/A INTRINSIC
low complexity region 232 248 N/A INTRINSIC
low complexity region 257 269 N/A INTRINSIC
low complexity region 343 367 N/A INTRINSIC
low complexity region 487 499 N/A INTRINSIC
low complexity region 529 543 N/A INTRINSIC
Pfam:PHC2_SAM_assoc 662 781 2.6e-55 PFAM
SAM 783 850 8.53e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106080
AA Change: Y190C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101690
Gene: ENSMUSG00000028796
AA Change: Y190C

DomainStartEndE-ValueType
low complexity region 15 41 N/A INTRINSIC
low complexity region 74 119 N/A INTRINSIC
low complexity region 126 152 N/A INTRINSIC
low complexity region 232 248 N/A INTRINSIC
low complexity region 257 269 N/A INTRINSIC
low complexity region 343 367 N/A INTRINSIC
low complexity region 487 499 N/A INTRINSIC
low complexity region 529 543 N/A INTRINSIC
PDB:2L8E|A 632 662 4e-7 PDB
low complexity region 743 755 N/A INTRINSIC
SAM 783 850 8.53e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000136377
AA Change: Y190C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116333
Gene: ENSMUSG00000028796
AA Change: Y190C

DomainStartEndE-ValueType
low complexity region 15 41 N/A INTRINSIC
low complexity region 74 119 N/A INTRINSIC
low complexity region 126 152 N/A INTRINSIC
low complexity region 232 248 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155653
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.3%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In Drosophila melanogaster, the 'Polycomb' group (PcG) of genes are part of a cellular memory system that is responsible for the stable inheritance of gene activity. PcG proteins form a large multimeric, chromatin-associated protein complex. The protein encoded by this gene has homology to the Drosophila PcG protein 'polyhomeotic' (Ph) and is known to heterodimerize with EDR1 and colocalize with BMI1 in interphase nuclei of human cells. The specific function in human cells has not yet been determined. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele have normal skulls but exhibit posterior homeotic transformations of the axial skeleton. Cultured mouse embryonic fibroblasts show defects in proliferation and premature senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 A T 5: 50,009,449 M187K possibly damaging Het
Adgrg3 A G 8: 95,036,261 I189V noncoding transcript Het
Ampd1 A G 3: 103,085,383 K147R possibly damaging Het
Apbb2 T C 5: 66,311,072 T561A probably damaging Het
Arfgef3 A T 10: 18,646,963 D438E probably benign Het
Atxn1 T A 13: 45,567,762 Q219L possibly damaging Het
AW551984 A T 9: 39,598,037 D269E probably benign Het
Cryab A G 9: 50,754,525 K72R possibly damaging Het
Dbn1 G A 13: 55,475,104 A522V probably benign Het
Dip2a A T 10: 76,286,407 *158R probably null Het
Edrf1 C T 7: 133,637,808 probably benign Het
Ern2 A T 7: 122,176,646 D408E probably benign Het
F830016B08Rik T C 18: 60,300,078 S78P probably damaging Het
Fah C A 7: 84,595,545 G137C probably damaging Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Foxd3 A G 4: 99,656,740 D39G probably damaging Het
Gm3854 C T 7: 6,353,845 P219L probably damaging Het
Gprin3 G A 6: 59,353,331 Q664* probably null Het
H2-Ob T C 17: 34,242,644 I119T probably benign Het
Hist1h3e A T 13: 23,562,226 V47E probably damaging Het
Hmgcll1 G A 9: 76,130,345 G174R probably damaging Het
Kbtbd11 T A 8: 15,029,118 C572* probably null Het
Kynu A T 2: 43,634,989 N315Y probably benign Het
Map1lc3b G A 8: 121,596,690 E100K probably benign Het
Matn2 T A 15: 34,355,607 Q33L possibly damaging Het
Mettl8 T C 2: 70,976,075 probably null Het
Neto1 A T 18: 86,494,815 N312Y probably damaging Het
Nhsl1 A G 10: 18,524,505 D493G probably benign Het
Nup210l A G 3: 90,170,024 E889G possibly damaging Het
Olfr1153 G A 2: 87,896,657 V153I probably benign Het
Olfr1383 C A 11: 49,524,126 S134R possibly damaging Het
Olfr1402 A G 3: 97,410,891 F97L probably benign Het
Olfr209 A C 16: 59,361,585 M211R possibly damaging Het
Olfr296-ps1 A G 7: 86,561,873 Y47C unknown Het
Olfr420 C T 1: 174,159,175 T134I probably benign Het
Olfr967 A T 9: 39,750,520 M45L probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Platr25 T C 13: 62,672,997 T347A possibly damaging Het
Plec T C 15: 76,174,853 E3655G probably damaging Het
Plekhg3 A T 12: 76,576,845 Q954L probably benign Het
Pnpla1 G A 17: 28,881,368 G403E probably benign Het
Prdm4 G A 10: 85,907,830 T187I possibly damaging Het
Prg4 T C 1: 150,454,766 probably benign Het
Prpf18 G A 2: 4,633,447 R312W probably damaging Het
Rnf213 T A 11: 119,414,548 V535D probably damaging Het
Rtcb A T 10: 85,955,774 N39K probably damaging Het
Slc4a3 G A 1: 75,554,697 probably null Het
Szt2 A C 4: 118,374,290 probably benign Het
Tfap2e A T 4: 126,721,864 V259D probably damaging Het
Trav19 A G 14: 53,845,798 D110G probably damaging Het
Ttc17 A C 2: 94,358,755 C749W probably damaging Het
Ttc8 A G 12: 98,982,494 K490E possibly damaging Het
Ube4b A G 4: 149,387,133 S99P probably damaging Het
Ubqln3 C T 7: 104,142,178 R235H probably damaging Het
Vmn2r61 A T 7: 42,299,818 D554V probably damaging Het
Vmn2r70 A T 7: 85,558,986 V761E probably damaging Het
Vmn2r97 T C 17: 18,947,599 I705T possibly damaging Het
Wwox G A 8: 114,488,952 C155Y probably damaging Het
Zfp451 T C 1: 33,803,244 probably benign Het
Other mutations in Phc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00727:Phc2 APN 4 128745844 missense probably damaging 1.00
IGL01470:Phc2 APN 4 128723110 missense probably benign 0.00
IGL02171:Phc2 APN 4 128711065 missense probably damaging 1.00
IGL02884:Phc2 APN 4 128708016 missense probably damaging 1.00
I1329:Phc2 UTSW 4 128711113 missense probably damaging 0.98
PIT4696001:Phc2 UTSW 4 128705202 missense probably damaging 1.00
R0483:Phc2 UTSW 4 128723307 unclassified probably benign
R0625:Phc2 UTSW 4 128723710 missense possibly damaging 0.80
R1392:Phc2 UTSW 4 128745087 missense possibly damaging 0.63
R1392:Phc2 UTSW 4 128745087 missense possibly damaging 0.63
R1429:Phc2 UTSW 4 128743555 missense probably damaging 1.00
R1701:Phc2 UTSW 4 128751607 missense probably damaging 1.00
R1820:Phc2 UTSW 4 128743543 missense probably damaging 0.99
R2011:Phc2 UTSW 4 128723585 missense probably benign 0.27
R2063:Phc2 UTSW 4 128747136 missense probably damaging 1.00
R2064:Phc2 UTSW 4 128747136 missense probably damaging 1.00
R2065:Phc2 UTSW 4 128747136 missense probably damaging 1.00
R2066:Phc2 UTSW 4 128747136 missense probably damaging 1.00
R2067:Phc2 UTSW 4 128747136 missense probably damaging 1.00
R2152:Phc2 UTSW 4 128745066 makesense probably null
R2375:Phc2 UTSW 4 128723025 missense probably benign
R2430:Phc2 UTSW 4 128707983 missense probably damaging 1.00
R3910:Phc2 UTSW 4 128743558 critical splice donor site probably null
R3911:Phc2 UTSW 4 128743558 critical splice donor site probably null
R3941:Phc2 UTSW 4 128747244 critical splice donor site probably null
R4108:Phc2 UTSW 4 128707983 missense probably damaging 1.00
R4585:Phc2 UTSW 4 128743510 missense probably damaging 1.00
R4731:Phc2 UTSW 4 128707971 missense probably damaging 1.00
R4801:Phc2 UTSW 4 128751598 missense probably damaging 1.00
R4802:Phc2 UTSW 4 128751598 missense probably damaging 1.00
R4948:Phc2 UTSW 4 128723115 missense probably benign 0.00
R5498:Phc2 UTSW 4 128708994 missense probably benign 0.37
R5712:Phc2 UTSW 4 128745095 missense probably damaging 1.00
R5742:Phc2 UTSW 4 128745868 missense probably damaging 1.00
R6298:Phc2 UTSW 4 128748189 missense possibly damaging 0.91
R6348:Phc2 UTSW 4 128705151 missense probably benign 0.00
R6630:Phc2 UTSW 4 128723630 missense probably damaging 0.97
R6925:Phc2 UTSW 4 128748134 missense probably damaging 1.00
R7067:Phc2 UTSW 4 128747141 missense probably benign 0.02
R7396:Phc2 UTSW 4 128748161 missense probably benign 0.21
X0012:Phc2 UTSW 4 128709052 missense probably damaging 0.99
X0017:Phc2 UTSW 4 128723272 missense probably damaging 0.99
X0023:Phc2 UTSW 4 128708043 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGAGATGGTCCTAAAGGCCG -3'
(R):5'- GGCACTGTAGGGTGACTTTC -3'

Sequencing Primer
(F):5'- TCCTAAAGGCCGCCACGTAG -3'
(R):5'- GGCTCCATCTTGGACCTGAC -3'
Posted On2018-03-15