Incidental Mutation 'R6272:Gprin3'
ID507390
Institutional Source Beutler Lab
Gene Symbol Gprin3
Ensembl Gene ENSMUSG00000045441
Gene NameGPRIN family member 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R6272 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location59347226-59426294 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 59353331 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 664 (Q664*)
Ref Sequence ENSEMBL: ENSMUSP00000051805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051065]
Predicted Effect probably null
Transcript: ENSMUST00000051065
AA Change: Q664*
SMART Domains Protein: ENSMUSP00000051805
Gene: ENSMUSG00000045441
AA Change: Q664*

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
low complexity region 311 329 N/A INTRINSIC
low complexity region 593 609 N/A INTRINSIC
Pfam:GRIN_C 627 758 2.7e-49 PFAM
Meta Mutation Damage Score 0.648 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.3%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 A T 5: 50,009,449 M187K possibly damaging Het
Adgrg3 A G 8: 95,036,261 I189V noncoding transcript Het
Ampd1 A G 3: 103,085,383 K147R possibly damaging Het
Apbb2 T C 5: 66,311,072 T561A probably damaging Het
Arfgef3 A T 10: 18,646,963 D438E probably benign Het
Atxn1 T A 13: 45,567,762 Q219L possibly damaging Het
AW551984 A T 9: 39,598,037 D269E probably benign Het
Cryab A G 9: 50,754,525 K72R possibly damaging Het
Dbn1 G A 13: 55,475,104 A522V probably benign Het
Dip2a A T 10: 76,286,407 *158R probably null Het
Edrf1 C T 7: 133,637,808 probably benign Het
Ern2 A T 7: 122,176,646 D408E probably benign Het
F830016B08Rik T C 18: 60,300,078 S78P probably damaging Het
Fah C A 7: 84,595,545 G137C probably damaging Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Foxd3 A G 4: 99,656,740 D39G probably damaging Het
Gm3854 C T 7: 6,353,845 P219L probably damaging Het
H2-Ob T C 17: 34,242,644 I119T probably benign Het
Hist1h3e A T 13: 23,562,226 V47E probably damaging Het
Hmgcll1 G A 9: 76,130,345 G174R probably damaging Het
Kbtbd11 T A 8: 15,029,118 C572* probably null Het
Kynu A T 2: 43,634,989 N315Y probably benign Het
Map1lc3b G A 8: 121,596,690 E100K probably benign Het
Matn2 T A 15: 34,355,607 Q33L possibly damaging Het
Mettl8 T C 2: 70,976,075 probably null Het
Neto1 A T 18: 86,494,815 N312Y probably damaging Het
Nhsl1 A G 10: 18,524,505 D493G probably benign Het
Nup210l A G 3: 90,170,024 E889G possibly damaging Het
Olfr1153 G A 2: 87,896,657 V153I probably benign Het
Olfr1383 C A 11: 49,524,126 S134R possibly damaging Het
Olfr1402 A G 3: 97,410,891 F97L probably benign Het
Olfr209 A C 16: 59,361,585 M211R possibly damaging Het
Olfr296-ps1 A G 7: 86,561,873 Y47C unknown Het
Olfr420 C T 1: 174,159,175 T134I probably benign Het
Olfr967 A T 9: 39,750,520 M45L probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Phc2 A G 4: 128,709,647 Y190C probably damaging Het
Platr25 T C 13: 62,672,997 T347A possibly damaging Het
Plec T C 15: 76,174,853 E3655G probably damaging Het
Plekhg3 A T 12: 76,576,845 Q954L probably benign Het
Pnpla1 G A 17: 28,881,368 G403E probably benign Het
Prdm4 G A 10: 85,907,830 T187I possibly damaging Het
Prg4 T C 1: 150,454,766 probably benign Het
Prpf18 G A 2: 4,633,447 R312W probably damaging Het
Rnf213 T A 11: 119,414,548 V535D probably damaging Het
Rtcb A T 10: 85,955,774 N39K probably damaging Het
Slc4a3 G A 1: 75,554,697 probably null Het
Szt2 A C 4: 118,374,290 probably benign Het
Tfap2e A T 4: 126,721,864 V259D probably damaging Het
Trav19 A G 14: 53,845,798 D110G probably damaging Het
Ttc17 A C 2: 94,358,755 C749W probably damaging Het
Ttc8 A G 12: 98,982,494 K490E possibly damaging Het
Ube4b A G 4: 149,387,133 S99P probably damaging Het
Ubqln3 C T 7: 104,142,178 R235H probably damaging Het
Vmn2r61 A T 7: 42,299,818 D554V probably damaging Het
Vmn2r70 A T 7: 85,558,986 V761E probably damaging Het
Vmn2r97 T C 17: 18,947,599 I705T possibly damaging Het
Wwox G A 8: 114,488,952 C155Y probably damaging Het
Zfp451 T C 1: 33,803,244 probably benign Het
Other mutations in Gprin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Gprin3 APN 6 59353837 missense possibly damaging 0.72
IGL02059:Gprin3 APN 6 59355325 utr 5 prime probably benign
IGL02080:Gprin3 APN 6 59354191 missense possibly damaging 0.91
IGL02183:Gprin3 APN 6 59353162 missense possibly damaging 0.87
IGL02267:Gprin3 APN 6 59354473 missense probably benign 0.02
IGL02801:Gprin3 APN 6 59354981 missense possibly damaging 0.53
IGL03212:Gprin3 APN 6 59355028 missense probably benign
R0505:Gprin3 UTSW 6 59353387 missense probably damaging 0.98
R0944:Gprin3 UTSW 6 59353915 missense possibly damaging 0.72
R1028:Gprin3 UTSW 6 59354609 missense possibly damaging 0.53
R1180:Gprin3 UTSW 6 59354936 missense possibly damaging 0.86
R1290:Gprin3 UTSW 6 59354464 missense possibly damaging 0.53
R2060:Gprin3 UTSW 6 59354519 missense possibly damaging 0.73
R2403:Gprin3 UTSW 6 59354149 missense probably benign 0.13
R3830:Gprin3 UTSW 6 59353633 missense probably benign 0.12
R3893:Gprin3 UTSW 6 59354479 missense probably benign 0.12
R3983:Gprin3 UTSW 6 59354560 missense possibly damaging 0.72
R4812:Gprin3 UTSW 6 59353365 missense possibly damaging 0.85
R4932:Gprin3 UTSW 6 59354173 missense probably benign 0.33
R4944:Gprin3 UTSW 6 59354659 missense probably benign 0.00
R5523:Gprin3 UTSW 6 59353946 nonsense probably null
R5677:Gprin3 UTSW 6 59353892 missense possibly damaging 0.73
R5772:Gprin3 UTSW 6 59354413 missense possibly damaging 0.86
R5879:Gprin3 UTSW 6 59354713 missense probably benign
R5881:Gprin3 UTSW 6 59354786 missense probably benign 0.18
R6044:Gprin3 UTSW 6 59353672 missense possibly damaging 0.72
R7140:Gprin3 UTSW 6 59355143 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TTGATCTTCGAGTCTGGCCAC -3'
(R):5'- AAGACAGTCATGAGTCTGAGCC -3'

Sequencing Primer
(F):5'- AGTCTGGCCACTTTGTGTTTTAAC -3'
(R):5'- ATGAGTCTGAGCCTGCCATCAG -3'
Posted On2018-03-15