Incidental Mutation 'R6272:Arfgef3'
ID507407
Institutional Source Beutler Lab
Gene Symbol Arfgef3
Ensembl Gene ENSMUSG00000019852
Gene NameARFGEF family member 3
SynonymsB930094H20Rik, D10Bwg1379e, BIG3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R6272 (G1)
Quality Score124.008
Status Validated
Chromosome10
Chromosomal Location18581839-18743949 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18646963 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 438 (D438E)
Ref Sequence ENSEMBL: ENSMUSP00000149210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019999] [ENSMUST00000215836]
Predicted Effect probably benign
Transcript: ENSMUST00000019999
AA Change: D438E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000019999
Gene: ENSMUSG00000019852
AA Change: D438E

DomainStartEndE-ValueType
Pfam:DCB 1 170 7.1e-15 PFAM
low complexity region 236 245 N/A INTRINSIC
low complexity region 276 295 N/A INTRINSIC
low complexity region 452 462 N/A INTRINSIC
Sec7 582 794 6e-54 SMART
Blast:Sec7 798 873 3e-20 BLAST
low complexity region 927 940 N/A INTRINSIC
Pfam:DUF1981 1237 1312 1.9e-14 PFAM
low complexity region 1641 1652 N/A INTRINSIC
low complexity region 1710 1723 N/A INTRINSIC
low complexity region 1838 1856 N/A INTRINSIC
low complexity region 2088 2099 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215836
AA Change: D438E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.3%
Validation Efficiency 98% (55/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased insulin granule biogenesis and insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 A T 5: 50,009,449 M187K possibly damaging Het
Adgrg3 A G 8: 95,036,261 I189V noncoding transcript Het
Ampd1 A G 3: 103,085,383 K147R possibly damaging Het
Apbb2 T C 5: 66,311,072 T561A probably damaging Het
Atxn1 T A 13: 45,567,762 Q219L possibly damaging Het
AW551984 A T 9: 39,598,037 D269E probably benign Het
Cryab A G 9: 50,754,525 K72R possibly damaging Het
Dbn1 G A 13: 55,475,104 A522V probably benign Het
Dip2a A T 10: 76,286,407 *158R probably null Het
Edrf1 C T 7: 133,637,808 probably benign Het
Ern2 A T 7: 122,176,646 D408E probably benign Het
F830016B08Rik T C 18: 60,300,078 S78P probably damaging Het
Fah C A 7: 84,595,545 G137C probably damaging Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Foxd3 A G 4: 99,656,740 D39G probably damaging Het
Gm3854 C T 7: 6,353,845 P219L probably damaging Het
Gprin3 G A 6: 59,353,331 Q664* probably null Het
H2-Ob T C 17: 34,242,644 I119T probably benign Het
Hist1h3e A T 13: 23,562,226 V47E probably damaging Het
Hmgcll1 G A 9: 76,130,345 G174R probably damaging Het
Kbtbd11 T A 8: 15,029,118 C572* probably null Het
Kynu A T 2: 43,634,989 N315Y probably benign Het
Map1lc3b G A 8: 121,596,690 E100K probably benign Het
Matn2 T A 15: 34,355,607 Q33L possibly damaging Het
Mettl8 T C 2: 70,976,075 probably null Het
Neto1 A T 18: 86,494,815 N312Y probably damaging Het
Nhsl1 A G 10: 18,524,505 D493G probably benign Het
Nup210l A G 3: 90,170,024 E889G possibly damaging Het
Olfr1153 G A 2: 87,896,657 V153I probably benign Het
Olfr1383 C A 11: 49,524,126 S134R possibly damaging Het
Olfr1402 A G 3: 97,410,891 F97L probably benign Het
Olfr209 A C 16: 59,361,585 M211R possibly damaging Het
Olfr296-ps1 A G 7: 86,561,873 Y47C unknown Het
Olfr420 C T 1: 174,159,175 T134I probably benign Het
Olfr967 A T 9: 39,750,520 M45L probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Phc2 A G 4: 128,709,647 Y190C probably damaging Het
Platr25 T C 13: 62,672,997 T347A possibly damaging Het
Plec T C 15: 76,174,853 E3655G probably damaging Het
Plekhg3 A T 12: 76,576,845 Q954L probably benign Het
Pnpla1 G A 17: 28,881,368 G403E probably benign Het
Prdm4 G A 10: 85,907,830 T187I possibly damaging Het
Prg4 T C 1: 150,454,766 probably benign Het
Prpf18 G A 2: 4,633,447 R312W probably damaging Het
Rnf213 T A 11: 119,414,548 V535D probably damaging Het
Rtcb A T 10: 85,955,774 N39K probably damaging Het
Slc4a3 G A 1: 75,554,697 probably null Het
Szt2 A C 4: 118,374,290 probably benign Het
Tfap2e A T 4: 126,721,864 V259D probably damaging Het
Trav19 A G 14: 53,845,798 D110G probably damaging Het
Ttc17 A C 2: 94,358,755 C749W probably damaging Het
Ttc8 A G 12: 98,982,494 K490E possibly damaging Het
Ube4b A G 4: 149,387,133 S99P probably damaging Het
Ubqln3 C T 7: 104,142,178 R235H probably damaging Het
Vmn2r61 A T 7: 42,299,818 D554V probably damaging Het
Vmn2r70 A T 7: 85,558,986 V761E probably damaging Het
Vmn2r97 T C 17: 18,947,599 I705T possibly damaging Het
Wwox G A 8: 114,488,952 C155Y probably damaging Het
Zfp451 T C 1: 33,803,244 probably benign Het
Other mutations in Arfgef3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Arfgef3 APN 10 18660604 missense probably benign 0.03
IGL00835:Arfgef3 APN 10 18661358 missense probably benign
IGL00961:Arfgef3 APN 10 18611237 missense probably damaging 1.00
IGL01400:Arfgef3 APN 10 18652706 missense probably damaging 1.00
IGL01501:Arfgef3 APN 10 18600560 missense possibly damaging 0.93
IGL01595:Arfgef3 APN 10 18594912 missense possibly damaging 0.93
IGL01695:Arfgef3 APN 10 18603419 missense probably benign 0.00
IGL01774:Arfgef3 APN 10 18743615 missense possibly damaging 0.94
IGL02348:Arfgef3 APN 10 18591347 missense probably benign 0.04
IGL02371:Arfgef3 APN 10 18646539 missense probably benign
IGL02400:Arfgef3 APN 10 18646257 missense probably damaging 1.00
IGL02630:Arfgef3 APN 10 18661392 splice site probably benign
IGL02815:Arfgef3 APN 10 18652551 missense probably damaging 1.00
IGL03178:Arfgef3 APN 10 18613225 missense probably damaging 1.00
IGL03182:Arfgef3 APN 10 18600544 missense probably damaging 1.00
IGL03267:Arfgef3 APN 10 18591882 missense probably damaging 1.00
IGL03294:Arfgef3 APN 10 18664912 missense probably damaging 0.97
IGL03410:Arfgef3 APN 10 18600490 missense probably damaging 1.00
Bow-wow UTSW 10 18646730 nonsense probably null
R0098:Arfgef3 UTSW 10 18589642 missense probably damaging 1.00
R0098:Arfgef3 UTSW 10 18589642 missense probably damaging 1.00
R0141:Arfgef3 UTSW 10 18597407 missense probably damaging 1.00
R0164:Arfgef3 UTSW 10 18647915 missense possibly damaging 0.77
R0164:Arfgef3 UTSW 10 18647915 missense possibly damaging 0.77
R0241:Arfgef3 UTSW 10 18599214 missense probably damaging 1.00
R0334:Arfgef3 UTSW 10 18592281 missense probably damaging 0.98
R0352:Arfgef3 UTSW 10 18661387 missense probably benign 0.17
R0415:Arfgef3 UTSW 10 18613127 splice site probably benign
R0417:Arfgef3 UTSW 10 18603511 missense probably damaging 1.00
R0442:Arfgef3 UTSW 10 18677815 splice site probably benign
R0507:Arfgef3 UTSW 10 18591621 missense probably damaging 1.00
R0573:Arfgef3 UTSW 10 18599288 missense probably damaging 1.00
R0582:Arfgef3 UTSW 10 18611290 missense probably damaging 1.00
R0609:Arfgef3 UTSW 10 18597431 missense probably benign 0.31
R0826:Arfgef3 UTSW 10 18589666 missense probably damaging 0.98
R0919:Arfgef3 UTSW 10 18589735 missense possibly damaging 0.89
R0980:Arfgef3 UTSW 10 18592118 missense possibly damaging 0.82
R1027:Arfgef3 UTSW 10 18591375 missense probably benign 0.02
R1140:Arfgef3 UTSW 10 18597348 missense possibly damaging 0.77
R1491:Arfgef3 UTSW 10 18646554 missense probably damaging 1.00
R1493:Arfgef3 UTSW 10 18630879 missense probably damaging 0.96
R1529:Arfgef3 UTSW 10 18613222 nonsense probably null
R1564:Arfgef3 UTSW 10 18591704 missense probably damaging 1.00
R1654:Arfgef3 UTSW 10 18625148 missense probably null 0.15
R1868:Arfgef3 UTSW 10 18661387 missense probably benign 0.17
R1876:Arfgef3 UTSW 10 18597356 missense probably damaging 1.00
R1908:Arfgef3 UTSW 10 18652763 missense possibly damaging 0.80
R2211:Arfgef3 UTSW 10 18592245 missense possibly damaging 0.54
R2316:Arfgef3 UTSW 10 18616953 missense probably benign 0.19
R2393:Arfgef3 UTSW 10 18597787 missense possibly damaging 0.88
R2407:Arfgef3 UTSW 10 18677866 missense possibly damaging 0.63
R3076:Arfgef3 UTSW 10 18603530 missense probably damaging 0.99
R3077:Arfgef3 UTSW 10 18603530 missense probably damaging 0.99
R3963:Arfgef3 UTSW 10 18592277 missense probably damaging 1.00
R4201:Arfgef3 UTSW 10 18619782 missense probably benign 0.01
R4241:Arfgef3 UTSW 10 18625164 missense probably damaging 1.00
R4244:Arfgef3 UTSW 10 18630420 missense probably damaging 1.00
R4395:Arfgef3 UTSW 10 18597709 missense probably damaging 1.00
R4455:Arfgef3 UTSW 10 18607675 missense probably benign 0.18
R4480:Arfgef3 UTSW 10 18600600 missense probably damaging 1.00
R4499:Arfgef3 UTSW 10 18608343 missense possibly damaging 0.95
R4589:Arfgef3 UTSW 10 18646199 missense probably damaging 1.00
R4635:Arfgef3 UTSW 10 18634855 missense probably damaging 1.00
R4776:Arfgef3 UTSW 10 18654247 missense probably benign
R4801:Arfgef3 UTSW 10 18591906 missense probably benign 0.00
R4802:Arfgef3 UTSW 10 18591906 missense probably benign 0.00
R4807:Arfgef3 UTSW 10 18646637 missense probably benign
R4828:Arfgef3 UTSW 10 18652693 missense probably damaging 0.99
R4861:Arfgef3 UTSW 10 18607731 missense probably benign 0.01
R4861:Arfgef3 UTSW 10 18607731 missense probably benign 0.01
R4917:Arfgef3 UTSW 10 18616890 missense probably damaging 0.99
R4918:Arfgef3 UTSW 10 18616890 missense probably damaging 0.99
R4922:Arfgef3 UTSW 10 18592186 missense probably damaging 0.97
R4929:Arfgef3 UTSW 10 18630851 missense probably benign 0.00
R4937:Arfgef3 UTSW 10 18589706 missense probably damaging 0.98
R5290:Arfgef3 UTSW 10 18600460 missense probably damaging 1.00
R5410:Arfgef3 UTSW 10 18611237 missense probably damaging 0.99
R5807:Arfgef3 UTSW 10 18647798 splice site probably null
R5832:Arfgef3 UTSW 10 18630420 missense probably damaging 1.00
R5887:Arfgef3 UTSW 10 18607665 nonsense probably null
R6302:Arfgef3 UTSW 10 18652841 missense probably damaging 0.97
R6397:Arfgef3 UTSW 10 18607665 nonsense probably null
R6495:Arfgef3 UTSW 10 18611202 critical splice donor site probably null
R6707:Arfgef3 UTSW 10 18621155 missense probably benign 0.11
R6814:Arfgef3 UTSW 10 18595019 missense probably damaging 1.00
R6830:Arfgef3 UTSW 10 18664889 critical splice donor site probably null
R6870:Arfgef3 UTSW 10 18646730 nonsense probably null
R6941:Arfgef3 UTSW 10 18625455 missense possibly damaging 0.66
R7094:Arfgef3 UTSW 10 18646439 missense probably damaging 1.00
R7179:Arfgef3 UTSW 10 18599267 missense probably damaging 1.00
R7204:Arfgef3 UTSW 10 18646462 missense probably damaging 1.00
R7247:Arfgef3 UTSW 10 18625391 missense probably benign 0.00
R7249:Arfgef3 UTSW 10 18630835 missense possibly damaging 0.62
R7318:Arfgef3 UTSW 10 18630463 missense possibly damaging 0.89
R7391:Arfgef3 UTSW 10 18646259 missense probably benign 0.05
X0026:Arfgef3 UTSW 10 18652626 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTGATGCTGATGTCAGGG -3'
(R):5'- ATACTGTGCAGTTGGCCAAG -3'

Sequencing Primer
(F):5'- ATGCTGATGTCAGGGCTCCTC -3'
(R):5'- GTGCAGTTGGCCAAGCTAATAACTC -3'
Posted On2018-03-15