Incidental Mutation 'R6272:Olfr209'
ID507422
Institutional Source Beutler Lab
Gene Symbol Olfr209
Ensembl Gene ENSMUSG00000095706
Gene Nameolfactory receptor 209
SynonymsMOR182-6, GA_x54KRFPKG5P-55590495-55589578
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.224) question?
Stock #R6272 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location59361160-59363993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 59361585 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 211 (M211R)
Ref Sequence ENSEMBL: ENSMUSP00000147068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055868] [ENSMUST00000208246] [ENSMUST00000208875] [ENSMUST00000213779]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055868
AA Change: M211R

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000053192
Gene: ENSMUSG00000095706
AA Change: M211R

DomainStartEndE-ValueType
Pfam:7tm_4 30 304 1.3e-49 PFAM
Pfam:7TM_GPCR_Srsx 34 303 1.3e-6 PFAM
Pfam:7tm_1 40 289 6.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208246
Predicted Effect possibly damaging
Transcript: ENSMUST00000208875
AA Change: M211R

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000213779
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.3%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 A T 5: 50,009,449 M187K possibly damaging Het
Adgrg3 A G 8: 95,036,261 I189V noncoding transcript Het
Ampd1 A G 3: 103,085,383 K147R possibly damaging Het
Apbb2 T C 5: 66,311,072 T561A probably damaging Het
Arfgef3 A T 10: 18,646,963 D438E probably benign Het
Atxn1 T A 13: 45,567,762 Q219L possibly damaging Het
AW551984 A T 9: 39,598,037 D269E probably benign Het
Cryab A G 9: 50,754,525 K72R possibly damaging Het
Dbn1 G A 13: 55,475,104 A522V probably benign Het
Dip2a A T 10: 76,286,407 *158R probably null Het
Edrf1 C T 7: 133,637,808 probably benign Het
Ern2 A T 7: 122,176,646 D408E probably benign Het
F830016B08Rik T C 18: 60,300,078 S78P probably damaging Het
Fah C A 7: 84,595,545 G137C probably damaging Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Foxd3 A G 4: 99,656,740 D39G probably damaging Het
Gm3854 C T 7: 6,353,845 P219L probably damaging Het
Gprin3 G A 6: 59,353,331 Q664* probably null Het
H2-Ob T C 17: 34,242,644 I119T probably benign Het
Hist1h3e A T 13: 23,562,226 V47E probably damaging Het
Hmgcll1 G A 9: 76,130,345 G174R probably damaging Het
Kbtbd11 T A 8: 15,029,118 C572* probably null Het
Kynu A T 2: 43,634,989 N315Y probably benign Het
Map1lc3b G A 8: 121,596,690 E100K probably benign Het
Matn2 T A 15: 34,355,607 Q33L possibly damaging Het
Mettl8 T C 2: 70,976,075 probably null Het
Neto1 A T 18: 86,494,815 N312Y probably damaging Het
Nhsl1 A G 10: 18,524,505 D493G probably benign Het
Nup210l A G 3: 90,170,024 E889G possibly damaging Het
Olfr1153 G A 2: 87,896,657 V153I probably benign Het
Olfr1383 C A 11: 49,524,126 S134R possibly damaging Het
Olfr1402 A G 3: 97,410,891 F97L probably benign Het
Olfr296-ps1 A G 7: 86,561,873 Y47C unknown Het
Olfr420 C T 1: 174,159,175 T134I probably benign Het
Olfr967 A T 9: 39,750,520 M45L probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Phc2 A G 4: 128,709,647 Y190C probably damaging Het
Platr25 T C 13: 62,672,997 T347A possibly damaging Het
Plec T C 15: 76,174,853 E3655G probably damaging Het
Plekhg3 A T 12: 76,576,845 Q954L probably benign Het
Pnpla1 G A 17: 28,881,368 G403E probably benign Het
Prdm4 G A 10: 85,907,830 T187I possibly damaging Het
Prg4 T C 1: 150,454,766 probably benign Het
Prpf18 G A 2: 4,633,447 R312W probably damaging Het
Rnf213 T A 11: 119,414,548 V535D probably damaging Het
Rtcb A T 10: 85,955,774 N39K probably damaging Het
Slc4a3 G A 1: 75,554,697 probably null Het
Szt2 A C 4: 118,374,290 probably benign Het
Tfap2e A T 4: 126,721,864 V259D probably damaging Het
Trav19 A G 14: 53,845,798 D110G probably damaging Het
Ttc17 A C 2: 94,358,755 C749W probably damaging Het
Ttc8 A G 12: 98,982,494 K490E possibly damaging Het
Ube4b A G 4: 149,387,133 S99P probably damaging Het
Ubqln3 C T 7: 104,142,178 R235H probably damaging Het
Vmn2r61 A T 7: 42,299,818 D554V probably damaging Het
Vmn2r70 A T 7: 85,558,986 V761E probably damaging Het
Vmn2r97 T C 17: 18,947,599 I705T possibly damaging Het
Wwox G A 8: 114,488,952 C155Y probably damaging Het
Zfp451 T C 1: 33,803,244 probably benign Het
Other mutations in Olfr209
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01083:Olfr209 APN 16 59361835 missense probably damaging 1.00
IGL01137:Olfr209 APN 16 59361972 missense probably benign 0.01
IGL01383:Olfr209 APN 16 59361953 missense probably benign 0.10
IGL01913:Olfr209 APN 16 59361931 missense probably damaging 1.00
IGL01914:Olfr209 APN 16 59361931 missense probably damaging 1.00
IGL02125:Olfr209 APN 16 59361516 missense probably benign
IGL02414:Olfr209 APN 16 59361714 missense probably damaging 1.00
IGL02512:Olfr209 APN 16 59361808 missense possibly damaging 0.95
PIT4495001:Olfr209 UTSW 16 59361508 missense probably damaging 0.99
R0029:Olfr209 UTSW 16 59361541 missense probably benign 0.00
R0531:Olfr209 UTSW 16 59361808 missense probably damaging 0.99
R1799:Olfr209 UTSW 16 59361880 missense probably benign 0.01
R1901:Olfr209 UTSW 16 59362163 missense probably benign 0.03
R1902:Olfr209 UTSW 16 59362163 missense probably benign 0.03
R1903:Olfr209 UTSW 16 59362163 missense probably benign 0.03
R1972:Olfr209 UTSW 16 59362113 missense probably damaging 0.96
R2471:Olfr209 UTSW 16 59361581 missense possibly damaging 0.79
R5013:Olfr209 UTSW 16 59361704 missense probably damaging 1.00
R5160:Olfr209 UTSW 16 59361766 missense probably damaging 1.00
R5883:Olfr209 UTSW 16 59361715 missense probably damaging 1.00
R6296:Olfr209 UTSW 16 59361406 missense probably benign 0.06
R6741:Olfr209 UTSW 16 59361555 missense probably damaging 1.00
R6928:Olfr209 UTSW 16 59361463 missense probably damaging 1.00
X0017:Olfr209 UTSW 16 59361639 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCTGATAATTATCTTTGTCAGAGCCAG -3'
(R):5'- GGTGATGTCCAACAGACTCTG -3'

Sequencing Primer
(F):5'- TTATCTTTGTCAGAGCCAGAGAGGAC -3'
(R):5'- GGTGATGTCCAACAGACTCTGTATTC -3'
Posted On2018-03-15