Incidental Mutation 'R6273:Tnik'
ID507439
Institutional Source Beutler Lab
Gene Symbol Tnik
Ensembl Gene ENSMUSG00000027692
Gene NameTRAF2 and NCK interacting kinase
SynonymsC630040K21Rik, 1500031A17Rik, 4831440I19Rik, C530008O15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6273 (G1)
Quality Score81.0075
Status Validated
Chromosome3
Chromosomal Location28263214-28675858 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28577500 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 383 (H383L)
Ref Sequence ENSEMBL: ENSMUSP00000124726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159236] [ENSMUST00000159308] [ENSMUST00000159680] [ENSMUST00000160307] [ENSMUST00000160518] [ENSMUST00000160934] [ENSMUST00000161964] [ENSMUST00000162485] [ENSMUST00000162777]
Predicted Effect possibly damaging
Transcript: ENSMUST00000159236
AA Change: H383L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124681
Gene: ENSMUSG00000027692
AA Change: H383L

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
low complexity region 793 812 N/A INTRINSIC
low complexity region 951 958 N/A INTRINSIC
CNH 1005 1303 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000159308
AA Change: H383L
SMART Domains Protein: ENSMUSP00000125466
Gene: ENSMUSG00000027692
AA Change: H383L

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 636 671 N/A INTRINSIC
low complexity region 746 765 N/A INTRINSIC
low complexity region 904 911 N/A INTRINSIC
CNH 958 1256 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000159680
AA Change: H383L
SMART Domains Protein: ENSMUSP00000124876
Gene: ENSMUSG00000027692
AA Change: H383L

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 720 755 N/A INTRINSIC
low complexity region 822 841 N/A INTRINSIC
low complexity region 980 987 N/A INTRINSIC
CNH 1034 1332 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000160307
AA Change: H383L
SMART Domains Protein: ENSMUSP00000125081
Gene: ENSMUSG00000027692
AA Change: H383L

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 720 755 N/A INTRINSIC
low complexity region 830 849 N/A INTRINSIC
low complexity region 988 995 N/A INTRINSIC
CNH 1042 1340 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000160518
AA Change: H383L
SMART Domains Protein: ENSMUSP00000124011
Gene: ENSMUSG00000027692
AA Change: H383L

DomainStartEndE-ValueType
S_TKc 25 289 5.9e-99 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
low complexity region 801 820 N/A INTRINSIC
low complexity region 959 966 N/A INTRINSIC
CNH 1013 1311 9.3e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160934
SMART Domains Protein: ENSMUSP00000123859
Gene: ENSMUSG00000027692

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 25 212 2.2e-37 PFAM
Pfam:Pkinase 25 219 5.9e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161423
Predicted Effect possibly damaging
Transcript: ENSMUST00000161964
AA Change: H383L

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125411
Gene: ENSMUSG00000027692
AA Change: H383L

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 636 671 N/A INTRINSIC
low complexity region 738 757 N/A INTRINSIC
low complexity region 896 903 N/A INTRINSIC
CNH 950 1248 1.92e-117 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162037
Predicted Effect unknown
Transcript: ENSMUST00000162485
AA Change: H383L
SMART Domains Protein: ENSMUSP00000124387
Gene: ENSMUSG00000027692
AA Change: H383L

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 665 700 N/A INTRINSIC
low complexity region 775 794 N/A INTRINSIC
low complexity region 933 940 N/A INTRINSIC
CNH 987 1285 1.92e-117 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000162777
AA Change: H383L

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124726
Gene: ENSMUSG00000027692
AA Change: H383L

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 665 700 N/A INTRINSIC
low complexity region 767 786 N/A INTRINSIC
low complexity region 925 932 N/A INTRINSIC
CNH 979 1277 1.92e-117 SMART
Meta Mutation Damage Score 0.216 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 98% (78/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Germinal center kinases (GCKs), such as TNIK, are characterized by an N-terminal kinase domain and a C-terminal GCK domain that serves a regulatory function (Fu et al., 1999 [PubMed 10521462]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired postsynaptic signaling and cognitive function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,218 I99N probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ankrd31 A G 13: 96,851,673 I1065V possibly damaging Het
Aox2 A G 1: 58,339,672 T1027A probably benign Het
Atm G A 9: 53,487,922 P1593L probably benign Het
Atp13a5 T G 16: 29,348,737 I132L probably benign Het
BC035044 A G 6: 128,890,889 probably benign Het
C530008M17Rik A T 5: 76,857,721 D643V unknown Het
Cadm3 CT C 1: 173,349,124 probably benign Homo
Car3 C T 3: 14,871,617 P247S probably benign Het
Ccdc7a T C 8: 128,787,338 Y160C probably damaging Het
Cd1d1 A G 3: 86,998,257 V143A probably benign Het
Cog6 A T 3: 52,996,052 F142I probably damaging Het
Crhr1 T G 11: 104,163,856 N98K possibly damaging Het
Csf1 A G 3: 107,749,163 V72A probably damaging Het
Cwc15 T A 9: 14,510,241 I201K probably benign Het
Dgka T C 10: 128,723,646 K482R probably benign Het
Dnah7b T C 1: 46,242,316 S2846P possibly damaging Het
Dst T A 1: 34,275,266 I4199N probably damaging Het
Dusp7 A G 9: 106,373,896 T407A possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fem1a T C 17: 56,257,083 Y59H possibly damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Filip1 A T 9: 79,815,886 D1150E probably benign Het
Gabra1 A G 11: 42,140,311 V264A probably damaging Het
Gm4131 T C 14: 62,464,850 E223G probably damaging Het
Gon4l T C 3: 88,855,849 V333A probably damaging Het
Gsk3b A G 16: 38,208,046 T289A probably benign Het
Hmcn2 T C 2: 31,411,834 S2912P probably damaging Het
Htr7 A T 19: 36,041,569 probably benign Het
Ibsp A G 5: 104,310,301 T235A probably benign Het
Ints13 A T 6: 146,565,681 D116E probably damaging Het
Kctd19 T C 8: 105,385,485 N753S probably benign Het
Mdn1 A G 4: 32,715,979 N2054D probably benign Het
Mink1 A T 11: 70,611,435 K880* probably null Het
Mrvi1 G T 7: 110,871,583 H848N probably benign Het
Myo15b T A 11: 115,862,799 L824Q possibly damaging Het
Napepld T C 5: 21,665,322 E366G probably benign Het
Obscn T A 11: 59,076,993 T2662S possibly damaging Het
Olfr130 T G 17: 38,067,795 L208R probably damaging Het
Olfr1302 T C 2: 111,781,222 F301L probably benign Het
Olfr133 T A 17: 38,148,942 M118K possibly damaging Het
Olfr1448 A G 19: 12,919,400 V303A probably benign Het
Olfr213 A G 6: 116,541,316 T288A possibly damaging Het
Olfr656 A G 7: 104,617,895 D72G probably damaging Het
Pah T C 10: 87,576,215 probably null Het
Panx3 T G 9: 37,667,429 I85L probably benign Het
Pate4 T C 9: 35,607,790 N94D probably benign Het
Pde4d A G 13: 109,950,221 M610V possibly damaging Het
Pik3c2b T C 1: 133,066,711 S138P probably benign Het
Pkn1 T C 8: 83,672,270 N696S probably damaging Het
Plppr2 A G 9: 21,944,505 E258G probably damaging Het
Plxnd1 A T 6: 115,978,492 M538K probably damaging Het
Prepl G T 17: 85,083,268 N87K probably benign Het
Prkag2 C A 5: 24,947,536 R190L probably damaging Het
Rara A G 11: 98,970,222 T179A probably benign Het
Rfx7 A G 9: 72,616,997 K490E possibly damaging Het
Rgsl1 C T 1: 153,827,465 V147M possibly damaging Het
Rph3a A G 5: 120,945,422 I595T possibly damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc8a2 T C 7: 16,145,334 F582L possibly damaging Het
Sprr2e A G 3: 92,352,864 M1V probably null Het
Steap1 T A 5: 5,740,827 R40S possibly damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Thsd7a A T 6: 12,408,836 V729E probably damaging Het
Tmem2 T A 19: 21,802,005 V393E probably damaging Het
Tmprss13 A G 9: 45,345,332 Y525C probably damaging Het
Vars T C 17: 35,013,743 L881S probably damaging Het
Vmn1r201 A C 13: 22,475,215 S200R probably damaging Het
Vmn2r14 A T 5: 109,221,267 W147R probably benign Het
Vmn2r-ps130 A T 17: 23,076,785 H643L probably benign Het
Vps53 T C 11: 76,102,018 E367G probably benign Het
Xab2 C T 8: 3,611,822 G544S probably damaging Het
Ythdf3 T A 3: 16,204,856 V400E possibly damaging Het
Zfand5 C T 19: 21,279,696 P147S probably benign Het
Zfp768 A T 7: 127,345,147 probably null Het
Zswim8 A G 14: 20,713,453 M423V probably benign Het
Other mutations in Tnik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Tnik APN 3 28654218 missense probably damaging 1.00
IGL00726:Tnik APN 3 28532898 missense probably damaging 1.00
IGL01022:Tnik APN 3 28625228 splice site probably null
IGL01145:Tnik APN 3 28604167 intron probably benign
IGL01664:Tnik APN 3 28638479 missense probably damaging 1.00
IGL01843:Tnik APN 3 28570858 splice site probably null
IGL02378:Tnik APN 3 28638459 nonsense probably null
IGL02448:Tnik APN 3 28621077 missense probably null 0.01
IGL02756:Tnik APN 3 28542030 missense probably damaging 1.00
IGL03332:Tnik APN 3 28666155 missense probably damaging 1.00
Usher UTSW 3 28564097 missense possibly damaging 0.61
R0135:Tnik UTSW 3 28607245 missense possibly damaging 0.67
R0418:Tnik UTSW 3 28570880 nonsense probably null
R0540:Tnik UTSW 3 28650159 missense probably damaging 1.00
R0549:Tnik UTSW 3 28570920 missense possibly damaging 0.87
R0556:Tnik UTSW 3 28625218 missense possibly damaging 0.95
R0586:Tnik UTSW 3 28577361 splice site probably benign
R0607:Tnik UTSW 3 28650159 missense probably damaging 1.00
R0842:Tnik UTSW 3 28594086 missense possibly damaging 0.72
R1068:Tnik UTSW 3 28532975 missense probably damaging 1.00
R1171:Tnik UTSW 3 28532940 missense probably damaging 1.00
R1597:Tnik UTSW 3 28604269 missense probably damaging 1.00
R1638:Tnik UTSW 3 28665740 missense probably damaging 0.99
R1652:Tnik UTSW 3 28604293 missense probably benign 0.22
R1996:Tnik UTSW 3 28665680 missense probably damaging 1.00
R2333:Tnik UTSW 3 28532996 missense probably damaging 1.00
R2426:Tnik UTSW 3 28646681 missense probably damaging 1.00
R2509:Tnik UTSW 3 28667915 missense probably damaging 1.00
R3774:Tnik UTSW 3 28638419 missense probably damaging 0.98
R3775:Tnik UTSW 3 28638419 missense probably damaging 0.98
R4007:Tnik UTSW 3 28604281 missense probably damaging 1.00
R4119:Tnik UTSW 3 28666175 missense probably damaging 1.00
R4209:Tnik UTSW 3 28359065 splice site probably benign
R4441:Tnik UTSW 3 28564097 missense possibly damaging 0.61
R4611:Tnik UTSW 3 28542100 critical splice donor site probably null
R4714:Tnik UTSW 3 28594077 missense possibly damaging 0.53
R4772:Tnik UTSW 3 28607210 missense probably benign 0.09
R4829:Tnik UTSW 3 28539541 intron probably benign
R4839:Tnik UTSW 3 28596075 missense possibly damaging 0.86
R4898:Tnik UTSW 3 28650086 missense probably damaging 1.00
R5029:Tnik UTSW 3 28665844 splice site probably null
R5278:Tnik UTSW 3 28650060 missense probably damaging 1.00
R5307:Tnik UTSW 3 28541972 missense probably damaging 1.00
R5330:Tnik UTSW 3 28542018 missense probably damaging 1.00
R5375:Tnik UTSW 3 28594092 missense probably benign 0.02
R5459:Tnik UTSW 3 28661741 missense probably damaging 1.00
R5708:Tnik UTSW 3 28611971 critical splice donor site probably null
R5749:Tnik UTSW 3 28594092 missense probably benign 0.02
R5751:Tnik UTSW 3 28594092 missense probably benign 0.02
R5780:Tnik UTSW 3 28594092 missense probably benign 0.02
R5837:Tnik UTSW 3 28668053 unclassified probably benign
R5969:Tnik UTSW 3 28620948 missense probably damaging 1.00
R6244:Tnik UTSW 3 28650179 missense probably damaging 1.00
R6457:Tnik UTSW 3 28539448 missense probably damaging 1.00
R6464:Tnik UTSW 3 28611970 critical splice donor site probably null
R6473:Tnik UTSW 3 28263643 start codon destroyed probably null 0.93
R6737:Tnik UTSW 3 28596086 missense possibly damaging 0.72
R7049:Tnik UTSW 3 28661704 nonsense probably null
X0022:Tnik UTSW 3 28667951 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAGTAGAGCACTGTTCTCTCC -3'
(R):5'- GTGAGTGGAGGCTCTTTTAAACAG -3'

Sequencing Primer
(F):5'- TAGCAATGGCCCTGTCATAG -3'
(R):5'- ACAGATGTTTTTCAAAGAGCGTGTG -3'
Posted On2018-03-15