Incidental Mutation 'R6273:Xab2'
ID507465
Institutional Source Beutler Lab
Gene Symbol Xab2
Ensembl Gene ENSMUSG00000019470
Gene NameXPA binding protein 2
Synonyms0610041O14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6273 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location3608421-3621316 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 3611822 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 544 (G544S)
Ref Sequence ENSEMBL: ENSMUSP00000019614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019614] [ENSMUST00000057028] [ENSMUST00000159235] [ENSMUST00000171962] [ENSMUST00000207077] [ENSMUST00000207432] [ENSMUST00000207533] [ENSMUST00000207712] [ENSMUST00000207970] [ENSMUST00000208240]
Predicted Effect probably damaging
Transcript: ENSMUST00000019614
AA Change: G544S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019614
Gene: ENSMUSG00000019470
AA Change: G544S

DomainStartEndE-ValueType
HAT 48 80 7.56e0 SMART
HAT 93 122 1.92e2 SMART
HAT 124 158 4.89e-2 SMART
HAT 270 305 3.82e-4 SMART
low complexity region 316 333 N/A INTRINSIC
HAT 409 445 1.88e1 SMART
HAT 447 496 2.32e2 SMART
HAT 498 530 1.56e1 SMART
HAT 532 566 5.84e0 SMART
HAT 571 605 3.62e-5 SMART
Blast:HAT 607 641 3e-14 BLAST
Blast:HAT 643 677 2e-15 BLAST
HAT 679 713 2.77e-1 SMART
low complexity region 771 785 N/A INTRINSIC
low complexity region 823 836 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057028
SMART Domains Protein: ENSMUSP00000058958
Gene: ENSMUSG00000044433

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 90 109 N/A INTRINSIC
Pfam:CH 166 315 5.5e-27 PFAM
Pfam:CAMSAP_CH 214 296 1.2e-29 PFAM
low complexity region 359 373 N/A INTRINSIC
coiled coil region 595 633 N/A INTRINSIC
low complexity region 645 655 N/A INTRINSIC
coiled coil region 696 727 N/A INTRINSIC
low complexity region 749 779 N/A INTRINSIC
low complexity region 828 837 N/A INTRINSIC
low complexity region 866 881 N/A INTRINSIC
coiled coil region 900 943 N/A INTRINSIC
low complexity region 944 965 N/A INTRINSIC
low complexity region 1002 1024 N/A INTRINSIC
CAMSAP_CKK 1111 1240 1.29e-86 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122654
Predicted Effect probably benign
Transcript: ENSMUST00000159235
SMART Domains Protein: ENSMUSP00000124237
Gene: ENSMUSG00000019470

DomainStartEndE-ValueType
Blast:HAT 12 47 2e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000159548
SMART Domains Protein: ENSMUSP00000124202
Gene: ENSMUSG00000019470

DomainStartEndE-ValueType
Blast:HAT 10 44 4e-12 BLAST
HAT 46 78 7.56e0 SMART
HAT 91 120 1.92e2 SMART
HAT 122 156 4.89e-2 SMART
Blast:HAT 157 190 4e-12 BLAST
Pfam:TPR_2 243 272 2.2e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163038
Predicted Effect probably benign
Transcript: ENSMUST00000171962
SMART Domains Protein: ENSMUSP00000125993
Gene: ENSMUSG00000044433

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 90 109 N/A INTRINSIC
Pfam:CAMSAP_CH 214 296 6e-31 PFAM
low complexity region 360 374 N/A INTRINSIC
Pfam:CAMSAP_CC1 587 645 1.1e-27 PFAM
low complexity region 646 656 N/A INTRINSIC
coiled coil region 697 728 N/A INTRINSIC
low complexity region 750 780 N/A INTRINSIC
low complexity region 829 838 N/A INTRINSIC
low complexity region 867 882 N/A INTRINSIC
coiled coil region 901 944 N/A INTRINSIC
low complexity region 945 966 N/A INTRINSIC
low complexity region 1003 1025 N/A INTRINSIC
CAMSAP_CKK 1112 1241 1.29e-86 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207077
Predicted Effect probably benign
Transcript: ENSMUST00000207152
Predicted Effect probably benign
Transcript: ENSMUST00000207432
Predicted Effect probably benign
Transcript: ENSMUST00000207533
Predicted Effect probably benign
Transcript: ENSMUST00000207712
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207930
Predicted Effect probably benign
Transcript: ENSMUST00000207970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208064
Predicted Effect probably benign
Transcript: ENSMUST00000208240
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 98% (78/80)
MGI Phenotype PHENOTYPE: Homozygous null embryos die by the blastocyst stage (E3.5) and some eight-cell stage embryos do not undergo compaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,218 I99N probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ankrd31 A G 13: 96,851,673 I1065V possibly damaging Het
Aox2 A G 1: 58,339,672 T1027A probably benign Het
Atm G A 9: 53,487,922 P1593L probably benign Het
Atp13a5 T G 16: 29,348,737 I132L probably benign Het
BC035044 A G 6: 128,890,889 probably benign Het
C530008M17Rik A T 5: 76,857,721 D643V unknown Het
Cadm3 CT C 1: 173,349,124 probably benign Homo
Car3 C T 3: 14,871,617 P247S probably benign Het
Ccdc7a T C 8: 128,787,338 Y160C probably damaging Het
Cd1d1 A G 3: 86,998,257 V143A probably benign Het
Cog6 A T 3: 52,996,052 F142I probably damaging Het
Crhr1 T G 11: 104,163,856 N98K possibly damaging Het
Csf1 A G 3: 107,749,163 V72A probably damaging Het
Cwc15 T A 9: 14,510,241 I201K probably benign Het
Dgka T C 10: 128,723,646 K482R probably benign Het
Dnah7b T C 1: 46,242,316 S2846P possibly damaging Het
Dst T A 1: 34,275,266 I4199N probably damaging Het
Dusp7 A G 9: 106,373,896 T407A possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fem1a T C 17: 56,257,083 Y59H possibly damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Filip1 A T 9: 79,815,886 D1150E probably benign Het
Gabra1 A G 11: 42,140,311 V264A probably damaging Het
Gm4131 T C 14: 62,464,850 E223G probably damaging Het
Gon4l T C 3: 88,855,849 V333A probably damaging Het
Gsk3b A G 16: 38,208,046 T289A probably benign Het
Hmcn2 T C 2: 31,411,834 S2912P probably damaging Het
Htr7 A T 19: 36,041,569 probably benign Het
Ibsp A G 5: 104,310,301 T235A probably benign Het
Ints13 A T 6: 146,565,681 D116E probably damaging Het
Kctd19 T C 8: 105,385,485 N753S probably benign Het
Mdn1 A G 4: 32,715,979 N2054D probably benign Het
Mink1 A T 11: 70,611,435 K880* probably null Het
Mrvi1 G T 7: 110,871,583 H848N probably benign Het
Myo15b T A 11: 115,862,799 L824Q possibly damaging Het
Napepld T C 5: 21,665,322 E366G probably benign Het
Obscn T A 11: 59,076,993 T2662S possibly damaging Het
Olfr130 T G 17: 38,067,795 L208R probably damaging Het
Olfr1302 T C 2: 111,781,222 F301L probably benign Het
Olfr133 T A 17: 38,148,942 M118K possibly damaging Het
Olfr1448 A G 19: 12,919,400 V303A probably benign Het
Olfr213 A G 6: 116,541,316 T288A possibly damaging Het
Olfr656 A G 7: 104,617,895 D72G probably damaging Het
Pah T C 10: 87,576,215 probably null Het
Panx3 T G 9: 37,667,429 I85L probably benign Het
Pate4 T C 9: 35,607,790 N94D probably benign Het
Pde4d A G 13: 109,950,221 M610V possibly damaging Het
Pik3c2b T C 1: 133,066,711 S138P probably benign Het
Pkn1 T C 8: 83,672,270 N696S probably damaging Het
Plppr2 A G 9: 21,944,505 E258G probably damaging Het
Plxnd1 A T 6: 115,978,492 M538K probably damaging Het
Prepl G T 17: 85,083,268 N87K probably benign Het
Prkag2 C A 5: 24,947,536 R190L probably damaging Het
Rara A G 11: 98,970,222 T179A probably benign Het
Rfx7 A G 9: 72,616,997 K490E possibly damaging Het
Rgsl1 C T 1: 153,827,465 V147M possibly damaging Het
Rph3a A G 5: 120,945,422 I595T possibly damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc8a2 T C 7: 16,145,334 F582L possibly damaging Het
Sprr2e A G 3: 92,352,864 M1V probably null Het
Steap1 T A 5: 5,740,827 R40S possibly damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Thsd7a A T 6: 12,408,836 V729E probably damaging Het
Tmem2 T A 19: 21,802,005 V393E probably damaging Het
Tmprss13 A G 9: 45,345,332 Y525C probably damaging Het
Tnik A T 3: 28,577,500 H383L possibly damaging Het
Vars T C 17: 35,013,743 L881S probably damaging Het
Vmn1r201 A C 13: 22,475,215 S200R probably damaging Het
Vmn2r14 A T 5: 109,221,267 W147R probably benign Het
Vmn2r-ps130 A T 17: 23,076,785 H643L probably benign Het
Vps53 T C 11: 76,102,018 E367G probably benign Het
Ythdf3 T A 3: 16,204,856 V400E possibly damaging Het
Zfand5 C T 19: 21,279,696 P147S probably benign Het
Zfp768 A T 7: 127,345,147 probably null Het
Zswim8 A G 14: 20,713,453 M423V probably benign Het
Other mutations in Xab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Xab2 APN 8 3611723 missense probably damaging 1.00
IGL01308:Xab2 APN 8 3616332 missense probably benign 0.07
IGL01324:Xab2 APN 8 3621232 missense possibly damaging 0.80
IGL01340:Xab2 APN 8 3614381 missense probably damaging 1.00
IGL01613:Xab2 APN 8 3610880 missense probably benign 0.01
IGL02622:Xab2 APN 8 3611699 missense probably benign 0.01
IGL02809:Xab2 APN 8 3610175 missense probably benign 0.00
R0066:Xab2 UTSW 8 3613880 missense probably damaging 1.00
R0066:Xab2 UTSW 8 3613880 missense probably damaging 1.00
R0544:Xab2 UTSW 8 3610994 missense probably damaging 1.00
R0607:Xab2 UTSW 8 3613605 missense probably benign 0.05
R0735:Xab2 UTSW 8 3613649 missense possibly damaging 0.50
R0943:Xab2 UTSW 8 3613667 missense probably benign 0.00
R1507:Xab2 UTSW 8 3616031 missense possibly damaging 0.93
R1664:Xab2 UTSW 8 3619068 unclassified probably null
R1954:Xab2 UTSW 8 3616094 missense probably damaging 0.96
R1955:Xab2 UTSW 8 3616094 missense probably damaging 0.96
R3767:Xab2 UTSW 8 3619053 missense probably damaging 1.00
R4399:Xab2 UTSW 8 3614244 critical splice donor site probably null
R4421:Xab2 UTSW 8 3614244 critical splice donor site probably null
R4440:Xab2 UTSW 8 3616353 missense probably benign 0.01
R4553:Xab2 UTSW 8 3611015 missense probably benign 0.00
R4580:Xab2 UTSW 8 3610162 missense probably damaging 1.00
R4608:Xab2 UTSW 8 3618105 missense probably benign 0.23
R4707:Xab2 UTSW 8 3618117 missense possibly damaging 0.92
R5522:Xab2 UTSW 8 3611718 missense probably benign 0.06
R6063:Xab2 UTSW 8 3613051 missense possibly damaging 0.93
R6487:Xab2 UTSW 8 3613879 missense possibly damaging 0.75
R7140:Xab2 UTSW 8 3618117 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACAAGGGTCCAGTTAGCAGC -3'
(R):5'- TTGTCCATGAGGTATCAGACTG -3'

Sequencing Primer
(F):5'- TTAGCAGCGCGCCACTC -3'
(R):5'- GTGTTTAGAAAGTCCCTATTGCACC -3'
Posted On2018-03-15