Incidental Mutation 'R6273:Vps53'
ID507483
Institutional Source Beutler Lab
Gene Symbol Vps53
Ensembl Gene ENSMUSG00000017288
Gene NameVPS53 GARP complex subunit
Synonyms2310040I21Rik, 3100002B05Rik, 2010002A08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6273 (G1)
Quality Score213.009
Status Validated
Chromosome11
Chromosomal Location76046226-76179647 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76102018 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 367 (E367G)
Ref Sequence ENSEMBL: ENSMUSP00000091554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056601] [ENSMUST00000094015] [ENSMUST00000108419] [ENSMUST00000166752] [ENSMUST00000167114] [ENSMUST00000169734]
Predicted Effect probably benign
Transcript: ENSMUST00000056601
AA Change: E396G

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000061317
Gene: ENSMUSG00000017288
AA Change: E396G

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
Pfam:DUF2450 25 225 5.9e-11 PFAM
Pfam:Vps53_N 39 453 1.9e-176 PFAM
low complexity region 520 533 N/A INTRINSIC
low complexity region 820 832 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094015
AA Change: E367G

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000091554
Gene: ENSMUSG00000017288
AA Change: E367G

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
Pfam:Vps53_N 39 96 6.2e-21 PFAM
Pfam:Vps53_N 93 424 1.4e-133 PFAM
low complexity region 491 504 N/A INTRINSIC
low complexity region 791 803 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108419
SMART Domains Protein: ENSMUSP00000104057
Gene: ENSMUSG00000017288

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
Pfam:DUF2450 25 224 4e-11 PFAM
Pfam:Vps53_N 39 233 5.2e-87 PFAM
Pfam:Vps53_N 226 276 1.6e-14 PFAM
low complexity region 343 356 N/A INTRINSIC
low complexity region 643 655 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166752
AA Change: E348G

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000129159
Gene: ENSMUSG00000017288
AA Change: E348G

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
Pfam:DUF2450 25 225 8.2e-12 PFAM
Pfam:Vps53_N 39 230 6e-87 PFAM
Pfam:Vps53_N 226 405 1.4e-60 PFAM
low complexity region 472 485 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167114
AA Change: E119G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000131663
Gene: ENSMUSG00000017288
AA Change: E119G

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
Pfam:Vps53_N 39 101 1.2e-21 PFAM
Pfam:Vps53_N 104 176 3.1e-15 PFAM
low complexity region 243 256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169734
SMART Domains Protein: ENSMUSP00000130499
Gene: ENSMUSG00000017288

DomainStartEndE-ValueType
Pfam:DUF2450 5 225 5.1e-12 PFAM
Pfam:Vps53_N 39 329 1e-137 PFAM
Meta Mutation Damage Score 0.156 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 98% (78/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to the yeast Vps53p protein. Vps53p is involved in retrograde vesicle trafficking in late Golgi. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E12.5 with trophoblast cell hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,218 I99N probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ankrd31 A G 13: 96,851,673 I1065V possibly damaging Het
Aox2 A G 1: 58,339,672 T1027A probably benign Het
Atm G A 9: 53,487,922 P1593L probably benign Het
Atp13a5 T G 16: 29,348,737 I132L probably benign Het
BC035044 A G 6: 128,890,889 probably benign Het
C530008M17Rik A T 5: 76,857,721 D643V unknown Het
Cadm3 CT C 1: 173,349,124 probably benign Homo
Car3 C T 3: 14,871,617 P247S probably benign Het
Ccdc7a T C 8: 128,787,338 Y160C probably damaging Het
Cd1d1 A G 3: 86,998,257 V143A probably benign Het
Cog6 A T 3: 52,996,052 F142I probably damaging Het
Crhr1 T G 11: 104,163,856 N98K possibly damaging Het
Csf1 A G 3: 107,749,163 V72A probably damaging Het
Cwc15 T A 9: 14,510,241 I201K probably benign Het
Dgka T C 10: 128,723,646 K482R probably benign Het
Dnah7b T C 1: 46,242,316 S2846P possibly damaging Het
Dst T A 1: 34,275,266 I4199N probably damaging Het
Dusp7 A G 9: 106,373,896 T407A possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fem1a T C 17: 56,257,083 Y59H possibly damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Filip1 A T 9: 79,815,886 D1150E probably benign Het
Gabra1 A G 11: 42,140,311 V264A probably damaging Het
Gm4131 T C 14: 62,464,850 E223G probably damaging Het
Gon4l T C 3: 88,855,849 V333A probably damaging Het
Gsk3b A G 16: 38,208,046 T289A probably benign Het
Hmcn2 T C 2: 31,411,834 S2912P probably damaging Het
Htr7 A T 19: 36,041,569 probably benign Het
Ibsp A G 5: 104,310,301 T235A probably benign Het
Ints13 A T 6: 146,565,681 D116E probably damaging Het
Kctd19 T C 8: 105,385,485 N753S probably benign Het
Mdn1 A G 4: 32,715,979 N2054D probably benign Het
Mink1 A T 11: 70,611,435 K880* probably null Het
Mrvi1 G T 7: 110,871,583 H848N probably benign Het
Myo15b T A 11: 115,862,799 L824Q possibly damaging Het
Napepld T C 5: 21,665,322 E366G probably benign Het
Obscn T A 11: 59,076,993 T2662S possibly damaging Het
Olfr130 T G 17: 38,067,795 L208R probably damaging Het
Olfr1302 T C 2: 111,781,222 F301L probably benign Het
Olfr133 T A 17: 38,148,942 M118K possibly damaging Het
Olfr1448 A G 19: 12,919,400 V303A probably benign Het
Olfr213 A G 6: 116,541,316 T288A possibly damaging Het
Olfr656 A G 7: 104,617,895 D72G probably damaging Het
Pah T C 10: 87,576,215 probably null Het
Panx3 T G 9: 37,667,429 I85L probably benign Het
Pate4 T C 9: 35,607,790 N94D probably benign Het
Pde4d A G 13: 109,950,221 M610V possibly damaging Het
Pik3c2b T C 1: 133,066,711 S138P probably benign Het
Pkn1 T C 8: 83,672,270 N696S probably damaging Het
Plppr2 A G 9: 21,944,505 E258G probably damaging Het
Plxnd1 A T 6: 115,978,492 M538K probably damaging Het
Prepl G T 17: 85,083,268 N87K probably benign Het
Prkag2 C A 5: 24,947,536 R190L probably damaging Het
Rara A G 11: 98,970,222 T179A probably benign Het
Rfx7 A G 9: 72,616,997 K490E possibly damaging Het
Rgsl1 C T 1: 153,827,465 V147M possibly damaging Het
Rph3a A G 5: 120,945,422 I595T possibly damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc8a2 T C 7: 16,145,334 F582L possibly damaging Het
Sprr2e A G 3: 92,352,864 M1V probably null Het
Steap1 T A 5: 5,740,827 R40S possibly damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Thsd7a A T 6: 12,408,836 V729E probably damaging Het
Tmem2 T A 19: 21,802,005 V393E probably damaging Het
Tmprss13 A G 9: 45,345,332 Y525C probably damaging Het
Tnik A T 3: 28,577,500 H383L possibly damaging Het
Vars T C 17: 35,013,743 L881S probably damaging Het
Vmn1r201 A C 13: 22,475,215 S200R probably damaging Het
Vmn2r14 A T 5: 109,221,267 W147R probably benign Het
Vmn2r-ps130 A T 17: 23,076,785 H643L probably benign Het
Xab2 C T 8: 3,611,822 G544S probably damaging Het
Ythdf3 T A 3: 16,204,856 V400E possibly damaging Het
Zfand5 C T 19: 21,279,696 P147S probably benign Het
Zfp768 A T 7: 127,345,147 probably null Het
Zswim8 A G 14: 20,713,453 M423V probably benign Het
Other mutations in Vps53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Vps53 APN 11 76077035 splice site probably null
IGL01596:Vps53 APN 11 76063037 missense probably damaging 1.00
IGL01655:Vps53 APN 11 76063034 missense probably damaging 0.97
IGL02275:Vps53 APN 11 76047123 missense probably benign 0.03
IGL02321:Vps53 APN 11 76048538 missense possibly damaging 0.60
IGL02581:Vps53 APN 11 76102057 missense probably damaging 0.99
IGL02821:Vps53 APN 11 76136317 splice site probably benign
IGL02958:Vps53 APN 11 76117711 missense probably damaging 1.00
IGL03001:Vps53 APN 11 76138324 missense probably damaging 1.00
PIT4519001:Vps53 UTSW 11 76117173 missense probably damaging 1.00
R0257:Vps53 UTSW 11 76177385 intron probably benign
R0391:Vps53 UTSW 11 76121579 missense probably benign 0.31
R0421:Vps53 UTSW 11 76082670 missense probably damaging 1.00
R0882:Vps53 UTSW 11 76082659 missense probably damaging 1.00
R2509:Vps53 UTSW 11 76066835 missense possibly damaging 0.49
R3622:Vps53 UTSW 11 76117783 missense probably benign 0.00
R5137:Vps53 UTSW 11 76166248 missense probably damaging 1.00
R5338:Vps53 UTSW 11 76081208 missense probably damaging 1.00
R5756:Vps53 UTSW 11 76092330 splice site probably benign
R5786:Vps53 UTSW 11 76063007 missense probably benign 0.08
R5961:Vps53 UTSW 11 76048490 missense probably damaging 1.00
R6059:Vps53 UTSW 11 76066867 missense possibly damaging 0.57
R6490:Vps53 UTSW 11 76077055 missense probably benign 0.03
R6657:Vps53 UTSW 11 76134427 missense probably damaging 1.00
R6671:Vps53 UTSW 11 76134506 missense probably damaging 1.00
R6772:Vps53 UTSW 11 76179498 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- GAGGCTCTTCTGCAACACATC -3'
(R):5'- GTGCCTCCAACCTTGTTATGAG -3'

Sequencing Primer
(F):5'- GCAGGAACATGGTTCTTCGTCATC -3'
(R):5'- CTCCAACCTTGTTATGAGGACAAATC -3'
Posted On2018-03-15