Incidental Mutation 'R6273:Tmem2'
ID507503
Institutional Source Beutler Lab
Gene Symbol Tmem2
Ensembl Gene ENSMUSG00000024754
Gene Nametransmembrane protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.706) question?
Stock #R6273 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location21778342-21858327 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21802005 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 393 (V393E)
Ref Sequence ENSEMBL: ENSMUSP00000093908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025663] [ENSMUST00000096194]
Predicted Effect probably damaging
Transcript: ENSMUST00000025663
AA Change: V393E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025663
Gene: ENSMUSG00000024754
AA Change: V393E

DomainStartEndE-ValueType
transmembrane domain 83 105 N/A INTRINSIC
G8 121 245 1.89e-44 SMART
Pfam:ILEI 265 360 2.1e-24 PFAM
Blast:PbH1 587 609 1e-6 BLAST
low complexity region 621 633 N/A INTRINSIC
PbH1 669 691 3.62e3 SMART
PbH1 711 733 1.84e3 SMART
PbH1 791 812 1.33e3 SMART
Pfam:ILEI 1243 1333 9e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000096194
AA Change: V393E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093908
Gene: ENSMUSG00000024754
AA Change: V393E

DomainStartEndE-ValueType
transmembrane domain 83 105 N/A INTRINSIC
G8 121 245 1.89e-44 SMART
Blast:PbH1 587 609 1e-6 BLAST
low complexity region 621 633 N/A INTRINSIC
PbH1 669 691 3.62e3 SMART
PbH1 711 733 1.84e3 SMART
PbH1 791 812 1.33e3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 98% (78/80)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,218 I99N probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ankrd31 A G 13: 96,851,673 I1065V possibly damaging Het
Aox2 A G 1: 58,339,672 T1027A probably benign Het
Atm G A 9: 53,487,922 P1593L probably benign Het
Atp13a5 T G 16: 29,348,737 I132L probably benign Het
BC035044 A G 6: 128,890,889 probably benign Het
C530008M17Rik A T 5: 76,857,721 D643V unknown Het
Cadm3 CT C 1: 173,349,124 probably benign Homo
Car3 C T 3: 14,871,617 P247S probably benign Het
Ccdc7a T C 8: 128,787,338 Y160C probably damaging Het
Cd1d1 A G 3: 86,998,257 V143A probably benign Het
Cog6 A T 3: 52,996,052 F142I probably damaging Het
Crhr1 T G 11: 104,163,856 N98K possibly damaging Het
Csf1 A G 3: 107,749,163 V72A probably damaging Het
Cwc15 T A 9: 14,510,241 I201K probably benign Het
Dgka T C 10: 128,723,646 K482R probably benign Het
Dnah7b T C 1: 46,242,316 S2846P possibly damaging Het
Dst T A 1: 34,275,266 I4199N probably damaging Het
Dusp7 A G 9: 106,373,896 T407A possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fem1a T C 17: 56,257,083 Y59H possibly damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Filip1 A T 9: 79,815,886 D1150E probably benign Het
Gabra1 A G 11: 42,140,311 V264A probably damaging Het
Gm4131 T C 14: 62,464,850 E223G probably damaging Het
Gon4l T C 3: 88,855,849 V333A probably damaging Het
Gsk3b A G 16: 38,208,046 T289A probably benign Het
Hmcn2 T C 2: 31,411,834 S2912P probably damaging Het
Htr7 A T 19: 36,041,569 probably benign Het
Ibsp A G 5: 104,310,301 T235A probably benign Het
Ints13 A T 6: 146,565,681 D116E probably damaging Het
Kctd19 T C 8: 105,385,485 N753S probably benign Het
Mdn1 A G 4: 32,715,979 N2054D probably benign Het
Mink1 A T 11: 70,611,435 K880* probably null Het
Mrvi1 G T 7: 110,871,583 H848N probably benign Het
Myo15b T A 11: 115,862,799 L824Q possibly damaging Het
Napepld T C 5: 21,665,322 E366G probably benign Het
Obscn T A 11: 59,076,993 T2662S possibly damaging Het
Olfr130 T G 17: 38,067,795 L208R probably damaging Het
Olfr1302 T C 2: 111,781,222 F301L probably benign Het
Olfr133 T A 17: 38,148,942 M118K possibly damaging Het
Olfr1448 A G 19: 12,919,400 V303A probably benign Het
Olfr213 A G 6: 116,541,316 T288A possibly damaging Het
Olfr656 A G 7: 104,617,895 D72G probably damaging Het
Pah T C 10: 87,576,215 probably null Het
Panx3 T G 9: 37,667,429 I85L probably benign Het
Pate4 T C 9: 35,607,790 N94D probably benign Het
Pde4d A G 13: 109,950,221 M610V possibly damaging Het
Pik3c2b T C 1: 133,066,711 S138P probably benign Het
Pkn1 T C 8: 83,672,270 N696S probably damaging Het
Plppr2 A G 9: 21,944,505 E258G probably damaging Het
Plxnd1 A T 6: 115,978,492 M538K probably damaging Het
Prepl G T 17: 85,083,268 N87K probably benign Het
Prkag2 C A 5: 24,947,536 R190L probably damaging Het
Rara A G 11: 98,970,222 T179A probably benign Het
Rfx7 A G 9: 72,616,997 K490E possibly damaging Het
Rgsl1 C T 1: 153,827,465 V147M possibly damaging Het
Rph3a A G 5: 120,945,422 I595T possibly damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc8a2 T C 7: 16,145,334 F582L possibly damaging Het
Sprr2e A G 3: 92,352,864 M1V probably null Het
Steap1 T A 5: 5,740,827 R40S possibly damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Thsd7a A T 6: 12,408,836 V729E probably damaging Het
Tmprss13 A G 9: 45,345,332 Y525C probably damaging Het
Tnik A T 3: 28,577,500 H383L possibly damaging Het
Vars T C 17: 35,013,743 L881S probably damaging Het
Vmn1r201 A C 13: 22,475,215 S200R probably damaging Het
Vmn2r14 A T 5: 109,221,267 W147R probably benign Het
Vmn2r-ps130 A T 17: 23,076,785 H643L probably benign Het
Vps53 T C 11: 76,102,018 E367G probably benign Het
Xab2 C T 8: 3,611,822 G544S probably damaging Het
Ythdf3 T A 3: 16,204,856 V400E possibly damaging Het
Zfand5 C T 19: 21,279,696 P147S probably benign Het
Zfp768 A T 7: 127,345,147 probably null Het
Zswim8 A G 14: 20,713,453 M423V probably benign Het
Other mutations in Tmem2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Tmem2 APN 19 21844757 missense possibly damaging 0.77
IGL01528:Tmem2 APN 19 21835545 missense possibly damaging 0.95
IGL01642:Tmem2 APN 19 21823901 missense probably damaging 1.00
IGL01693:Tmem2 APN 19 21801887 missense probably benign 0.00
IGL02437:Tmem2 APN 19 21811978 critical splice donor site probably null
IGL02869:Tmem2 APN 19 21811877 missense probably damaging 0.99
IGL02880:Tmem2 APN 19 21823843 missense possibly damaging 0.68
IGL02904:Tmem2 APN 19 21823843 missense possibly damaging 0.68
IGL02941:Tmem2 APN 19 21823843 missense possibly damaging 0.68
IGL02950:Tmem2 APN 19 21842200 missense probably benign 0.07
IGL03066:Tmem2 APN 19 21823843 missense possibly damaging 0.68
IGL03120:Tmem2 APN 19 21823843 missense possibly damaging 0.68
R0005:Tmem2 UTSW 19 21812220 missense probably damaging 0.98
R0496:Tmem2 UTSW 19 21797345 missense possibly damaging 0.89
R0557:Tmem2 UTSW 19 21811903 missense probably benign 0.05
R0620:Tmem2 UTSW 19 21817971 missense probably benign
R1271:Tmem2 UTSW 19 21823904 missense possibly damaging 0.92
R1435:Tmem2 UTSW 19 21844706 missense probably benign
R1543:Tmem2 UTSW 19 21812573 missense probably benign 0.03
R1558:Tmem2 UTSW 19 21797982 nonsense probably null
R1658:Tmem2 UTSW 19 21801879 missense probably damaging 1.00
R1744:Tmem2 UTSW 19 21832137 nonsense probably null
R1859:Tmem2 UTSW 19 21847977 missense possibly damaging 0.56
R1943:Tmem2 UTSW 19 21848040 splice site probably null
R2001:Tmem2 UTSW 19 21801987 missense probably benign 0.43
R2021:Tmem2 UTSW 19 21844750 missense possibly damaging 0.91
R2177:Tmem2 UTSW 19 21811785 missense possibly damaging 0.80
R2183:Tmem2 UTSW 19 21823793 missense possibly damaging 0.81
R2921:Tmem2 UTSW 19 21817939 missense possibly damaging 0.80
R2922:Tmem2 UTSW 19 21817939 missense possibly damaging 0.80
R2923:Tmem2 UTSW 19 21817939 missense possibly damaging 0.80
R3727:Tmem2 UTSW 19 21844711 missense probably benign
R3730:Tmem2 UTSW 19 21826117 missense probably damaging 0.97
R3790:Tmem2 UTSW 19 21807452 missense probably damaging 1.00
R3831:Tmem2 UTSW 19 21847951 missense probably damaging 0.97
R3858:Tmem2 UTSW 19 21852234 missense probably benign 0.01
R3859:Tmem2 UTSW 19 21852234 missense probably benign 0.01
R3899:Tmem2 UTSW 19 21852234 missense probably benign 0.01
R4096:Tmem2 UTSW 19 21792652 start codon destroyed probably null 0.99
R4206:Tmem2 UTSW 19 21842115 missense probably damaging 1.00
R4480:Tmem2 UTSW 19 21815489 missense probably benign 0.03
R4667:Tmem2 UTSW 19 21797351 missense probably benign 0.00
R4667:Tmem2 UTSW 19 21844781 missense probably benign
R4888:Tmem2 UTSW 19 21856164 missense probably benign 0.00
R4914:Tmem2 UTSW 19 21809289 missense probably benign 0.00
R5030:Tmem2 UTSW 19 21842105 missense probably benign
R5329:Tmem2 UTSW 19 21798329 missense probably benign 0.30
R5977:Tmem2 UTSW 19 21826083 missense probably benign 0.01
R6013:Tmem2 UTSW 19 21832039 missense possibly damaging 0.89
R6049:Tmem2 UTSW 19 21826126 missense probably benign
R6199:Tmem2 UTSW 19 21844822 missense probably benign 0.05
R6215:Tmem2 UTSW 19 21812387 missense probably benign 0.02
R6429:Tmem2 UTSW 19 21801908 missense probably benign 0.14
R6547:Tmem2 UTSW 19 21844831 missense probably benign 0.01
R6630:Tmem2 UTSW 19 21852229 missense probably damaging 0.99
R6870:Tmem2 UTSW 19 21832123 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TGACAAATGACCAGCTGTGC -3'
(R):5'- AATAGATCAGTAGCTCGTCTAGACTTC -3'

Sequencing Primer
(F):5'- CTTGCTGTTTCTTCCTTATAGGCAAG -3'
(R):5'- CAGTAGCTCGTCTAGACTTCTTGAG -3'
Posted On2018-03-15