Incidental Mutation 'R6276:Map2'
ID507613
Institutional Source Beutler Lab
Gene Symbol Map2
Ensembl Gene ENSMUSG00000015222
Gene Namemicrotubule-associated protein 2
Synonymsrepro4, MAP-2, Mtap2, G1-397-34
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.544) question?
Stock #R6276 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location66175273-66442583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66399419 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 34 (V34A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024639] [ENSMUST00000077355] [ENSMUST00000114012] [ENSMUST00000114013] [ENSMUST00000114015] [ENSMUST00000114017] [ENSMUST00000114018] [ENSMUST00000123647] [ENSMUST00000145419] [ENSMUST00000173855]
Predicted Effect probably damaging
Transcript: ENSMUST00000024639
AA Change: V98A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000024639
Gene: ENSMUSG00000015222
AA Change: V98A

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000077355
AA Change: V98A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000076577
Gene: ENSMUSG00000015222
AA Change: V98A

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114012
AA Change: V98A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109645
Gene: ENSMUSG00000015222
AA Change: V98A

DomainStartEndE-ValueType
low complexity region 133 140 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
low complexity region 205 221 N/A INTRINSIC
low complexity region 228 250 N/A INTRINSIC
Pfam:Tubulin-binding 299 330 2.1e-18 PFAM
Pfam:Tubulin-binding 331 361 9.1e-20 PFAM
Pfam:Tubulin-binding 362 393 1.7e-17 PFAM
low complexity region 421 434 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114013
AA Change: V98A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109646
Gene: ENSMUSG00000015222
AA Change: V98A

DomainStartEndE-ValueType
Pfam:RII_binding_1 86 103 1.2e-5 PFAM
low complexity region 120 141 N/A INTRINSIC
Pfam:MAP2_projctn 376 1510 N/A PFAM
low complexity region 1543 1557 N/A INTRINSIC
low complexity region 1567 1583 N/A INTRINSIC
low complexity region 1590 1612 N/A INTRINSIC
Pfam:Tubulin-binding 1662 1692 1.7e-13 PFAM
Pfam:Tubulin-binding 1693 1723 5.8e-18 PFAM
Pfam:Tubulin-binding 1724 1755 5.9e-18 PFAM
low complexity region 1783 1796 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114015
AA Change: V98A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109648
Gene: ENSMUSG00000015222
AA Change: V98A

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114017
AA Change: V98A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109650
Gene: ENSMUSG00000015222
AA Change: V98A

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.3e-18 PFAM
Pfam:Tubulin-binding 332 362 2.3e-19 PFAM
Pfam:Tubulin-binding 363 393 9.9e-20 PFAM
Pfam:Tubulin-binding 394 425 1.9e-17 PFAM
low complexity region 453 466 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114018
AA Change: V98A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109651
Gene: ENSMUSG00000015222
AA Change: V98A

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.3e-18 PFAM
Pfam:Tubulin-binding 332 362 2.3e-19 PFAM
Pfam:Tubulin-binding 363 393 9.9e-20 PFAM
Pfam:Tubulin-binding 394 425 1.9e-17 PFAM
low complexity region 453 466 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000123647
AA Change: V98A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119341
Gene: ENSMUSG00000015222
AA Change: V98A

DomainStartEndE-ValueType
Pfam:RII_binding_1 86 103 3.8e-5 PFAM
low complexity region 120 135 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128673
Predicted Effect probably damaging
Transcript: ENSMUST00000141148
AA Change: V34A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117996
Gene: ENSMUSG00000015222
AA Change: V34A

DomainStartEndE-ValueType
Pfam:RII_binding_1 23 40 3.2e-6 PFAM
low complexity region 70 77 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145419
SMART Domains Protein: ENSMUSP00000134538
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
Pfam:MAP2_projctn 218 608 1.7e-250 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151423
Predicted Effect possibly damaging
Transcript: ENSMUST00000173855
AA Change: V98A

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134471
Gene: ENSMUSG00000015222
AA Change: V98A

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 142 163 N/A INTRINSIC
Pfam:MAP2_projctn 458 565 1.1e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174590
Meta Mutation Damage Score 0.178 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The products of similar genes in rat and mouse are neuron-specific cytoskeletal proteins that are enriched in dentrites, implicating a role in determining and stabilizing dentritic shape during neuron development. A number of alternatively spliced variants encoding distinct isoforms have been described. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered contextual memory. Mice homozygous for another knock-out allele display decreased body weight, altered microtubule density and organization in Purkinje cell dendrites, and reduced dendritic length inhippocampal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik T A 11: 58,446,366 I94L possibly damaging Het
4931406P16Rik A T 7: 34,242,377 Y627* probably null Het
Actr3 A T 1: 125,395,137 D364E probably benign Het
Adra2c C T 5: 35,280,079 T65I probably damaging Het
Agap2 T A 10: 127,089,360 probably null Het
Ager T C 17: 34,598,754 V126A possibly damaging Het
Arhgap39 T C 15: 76,737,536 I288M probably benign Het
Arhgap45 A T 10: 80,026,234 S541C probably benign Het
Asb4 A G 6: 5,431,043 Y426C probably damaging Het
Azi2 C T 9: 118,049,338 T82I probably damaging Het
Baz2b T A 2: 59,948,223 R764S probably damaging Het
Ccdc146 A C 5: 21,301,340 I701S probably damaging Het
Cd55b T A 1: 130,418,166 I172F probably damaging Het
Cdk11b A G 4: 155,634,190 E199G probably benign Het
Cntnap4 A T 8: 112,752,289 T216S possibly damaging Het
D5Ertd579e A T 5: 36,604,514 N1336K possibly damaging Het
Dlg5 T C 14: 24,164,568 N649S probably damaging Het
Dmxl1 A G 18: 49,846,586 E96G probably benign Het
Dscaml1 C T 9: 45,668,160 T335I possibly damaging Het
Epb41l2 G T 10: 25,502,124 G695C probably damaging Het
Erbb4 C T 1: 68,560,576 R114H probably damaging Het
F2rl1 G T 13: 95,513,938 Y145* probably null Het
Fam58b T C 11: 78,751,230 K145E probably damaging Het
Fsip2 A T 2: 82,980,441 Y2368F possibly damaging Het
Galnt7 C T 8: 57,536,578 probably null Het
Gm6811 T A 17: 21,093,983 noncoding transcript Het
Gm6811 T G 17: 21,094,690 noncoding transcript Het
H2-M1 G A 17: 36,671,710 T86M possibly damaging Het
Hk2 T C 6: 82,743,366 D170G probably benign Het
Hmcn1 C T 1: 150,738,681 A1325T possibly damaging Het
Insrr T A 3: 87,800,519 Y89* probably null Het
Itga1 T C 13: 114,980,852 E871G probably benign Het
Kat6a T C 8: 22,939,405 L1592P possibly damaging Het
Kndc1 C A 7: 139,921,063 A756E probably benign Het
Krt12 A T 11: 99,421,902 C105* probably null Het
Lama1 G A 17: 67,784,088 probably null Het
Lama3 A G 18: 12,506,949 N67S probably benign Het
Lrrk1 A G 7: 66,306,839 probably null Het
Mroh6 A G 15: 75,885,700 L487P probably damaging Het
Myo18b A T 5: 112,811,642 S1430T probably benign Het
Notch3 G A 17: 32,154,749 T495I probably benign Het
Olfr391-ps A T 11: 73,799,403 M118K probably damaging Het
Palld C T 8: 61,513,423 A980T probably damaging Het
Paxip1 A T 5: 27,761,668 I620N probably damaging Het
Pcdha6 A G 18: 36,969,767 probably null Het
Pcdhb11 G A 18: 37,421,760 V48M probably benign Het
Pcdhga6 A G 18: 37,707,644 E139G probably benign Het
Pck1 T C 2: 173,157,319 V426A probably damaging Het
Pck2 T A 14: 55,542,624 I110N probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phactr3 G A 2: 178,279,019 E222K probably damaging Het
Ppip5k1 A T 2: 121,323,203 probably benign Het
Prodh2 A G 7: 30,506,651 H278R probably benign Het
Rspry1 T A 8: 94,623,258 H91Q probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Smn1 A G 13: 100,127,995 N78S possibly damaging Het
Spta1 T A 1: 174,218,512 I1614N probably damaging Het
Syt17 T C 7: 118,434,290 D165G probably damaging Het
Tbck A G 3: 132,743,005 Y593C probably damaging Het
Tcaf2 G C 6: 42,629,753 F422L probably benign Het
Tex15 T A 8: 33,577,189 F2216I possibly damaging Het
Trpc4 A G 3: 54,318,020 E846G probably benign Het
Ttc41 T C 10: 86,744,449 I753T probably benign Het
Vdac1 C T 11: 52,376,482 T70M possibly damaging Het
Vmn1r124 A C 7: 21,260,179 F147V probably benign Het
Vmn1r220 T C 13: 23,184,295 D77G probably damaging Het
Vmn2r28 T C 7: 5,490,731 H72R probably benign Het
Vmn2r78 A T 7: 86,921,110 I279L probably benign Het
Vmn2r95 G T 17: 18,451,470 A490S possibly damaging Het
Wdfy4 C T 14: 33,109,525 A915T possibly damaging Het
Zmiz2 G T 11: 6,395,604 probably null Het
Zscan2 A G 7: 80,875,809 N426S probably benign Het
Other mutations in Map2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Map2 APN 1 66425331 missense probably damaging 1.00
IGL02135:Map2 APN 1 66380761 nonsense probably null
IGL02526:Map2 APN 1 66380717 missense possibly damaging 0.94
Annas UTSW 1 66433597 critical splice donor site probably null
calliope UTSW 1 66425298 missense probably damaging 1.00
ruby_throat UTSW 1 66414884 missense possibly damaging 0.67
E0370:Map2 UTSW 1 66416724 unclassified probably benign
R0067:Map2 UTSW 1 66413163 missense probably benign 0.04
R0238:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0238:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0239:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0239:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0268:Map2 UTSW 1 66380722 nonsense probably null
R0302:Map2 UTSW 1 66414828 missense probably benign 0.15
R0305:Map2 UTSW 1 66413094 missense probably benign 0.00
R0409:Map2 UTSW 1 66433580 missense probably damaging 1.00
R0561:Map2 UTSW 1 66425497 missense probably damaging 1.00
R0674:Map2 UTSW 1 66413202 missense probably damaging 1.00
R0738:Map2 UTSW 1 66425189 splice site probably benign
R0893:Map2 UTSW 1 66380768 missense probably damaging 1.00
R1305:Map2 UTSW 1 66425395 missense probably damaging 1.00
R1534:Map2 UTSW 1 66413180 missense probably benign 0.33
R1632:Map2 UTSW 1 66415086 missense possibly damaging 0.60
R1682:Map2 UTSW 1 66415622 unclassified probably null
R1774:Map2 UTSW 1 66414074 missense probably damaging 1.00
R2014:Map2 UTSW 1 66416136 missense possibly damaging 0.55
R2017:Map2 UTSW 1 66412799 missense probably damaging 1.00
R2050:Map2 UTSW 1 66414314 missense probably damaging 0.98
R2093:Map2 UTSW 1 66399440 missense probably damaging 1.00
R2214:Map2 UTSW 1 66420186 missense probably damaging 0.99
R2284:Map2 UTSW 1 66414068 missense probably damaging 1.00
R3011:Map2 UTSW 1 66414612 missense probably damaging 1.00
R3105:Map2 UTSW 1 66433597 critical splice donor site probably null
R3708:Map2 UTSW 1 66416555 unclassified probably benign
R3709:Map2 UTSW 1 66415856 nonsense probably null
R3729:Map2 UTSW 1 66412446 missense possibly damaging 0.80
R3760:Map2 UTSW 1 66438918 missense probably damaging 1.00
R3788:Map2 UTSW 1 66416863 missense probably damaging 0.99
R3789:Map2 UTSW 1 66416863 missense probably damaging 0.99
R4003:Map2 UTSW 1 66415740 missense probably damaging 1.00
R4120:Map2 UTSW 1 66415904 missense probably damaging 1.00
R4172:Map2 UTSW 1 66413600 missense possibly damaging 0.89
R4198:Map2 UTSW 1 66425298 missense probably damaging 1.00
R4200:Map2 UTSW 1 66425298 missense probably damaging 1.00
R4205:Map2 UTSW 1 66425290 missense probably damaging 1.00
R4613:Map2 UTSW 1 66425469 missense probably damaging 1.00
R4700:Map2 UTSW 1 66410637 missense probably damaging 0.96
R4974:Map2 UTSW 1 66413505 missense probably benign 0.15
R5007:Map2 UTSW 1 66413289 missense possibly damaging 0.86
R5039:Map2 UTSW 1 66438796 missense probably damaging 1.00
R5237:Map2 UTSW 1 66439010 unclassified probably benign
R5313:Map2 UTSW 1 66425379 missense probably damaging 1.00
R5455:Map2 UTSW 1 66399391 missense probably damaging 1.00
R5490:Map2 UTSW 1 66413133 missense probably damaging 1.00
R5517:Map2 UTSW 1 66415256 missense probably benign 0.00
R5532:Map2 UTSW 1 66414620 missense probably damaging 1.00
R5583:Map2 UTSW 1 66416037 missense probably damaging 1.00
R5764:Map2 UTSW 1 66414875 missense probably damaging 0.99
R5996:Map2 UTSW 1 66414884 missense possibly damaging 0.67
R6058:Map2 UTSW 1 66415414 missense probably benign 0.05
R6199:Map2 UTSW 1 66425478 missense probably damaging 1.00
R6208:Map2 UTSW 1 66431590 missense probably damaging 1.00
R6378:Map2 UTSW 1 66415329 missense probably damaging 1.00
R6424:Map2 UTSW 1 66414787 missense possibly damaging 0.67
R6743:Map2 UTSW 1 66415607 missense probably benign 0.04
R6837:Map2 UTSW 1 66414572 missense probably damaging 1.00
R6901:Map2 UTSW 1 66421773 missense possibly damaging 0.94
R6984:Map2 UTSW 1 66415236 missense possibly damaging 0.90
R6989:Map2 UTSW 1 66414906 missense probably benign 0.00
V8831:Map2 UTSW 1 66415845 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGACCCTAGAAGAAAAGTTCTC -3'
(R):5'- TGCTTCTAGTAGAGGTGACAGG -3'

Sequencing Primer
(F):5'- GACCCTAGAAGAAAAGTTCTCAATTG -3'
(R):5'- CTTCTAGTAGAGGTGACAGGTGAATG -3'
Posted On2018-03-15