Incidental Mutation 'R6276:Tex15'
ID507647
Institutional Source Beutler Lab
Gene Symbol Tex15
Ensembl Gene ENSMUSG00000009628
Gene Nametestis expressed gene 15
Synonyms2210014E14Rik
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_031374.2; MGI: 1934816

Is this an essential gene? Possibly essential (E-score: 0.515) question?
Stock #R6276 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location33516738-33585582 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33577189 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 2216 (F2216I)
Ref Sequence ENSEMBL: ENSMUSP00000009772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009772] [ENSMUST00000124496] [ENSMUST00000124501]
Predicted Effect possibly damaging
Transcript: ENSMUST00000009772
AA Change: F2216I

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000009772
Gene: ENSMUSG00000009628
AA Change: F2216I

DomainStartEndE-ValueType
low complexity region 262 274 N/A INTRINSIC
low complexity region 302 313 N/A INTRINSIC
low complexity region 524 536 N/A INTRINSIC
low complexity region 665 674 N/A INTRINSIC
low complexity region 713 725 N/A INTRINSIC
low complexity region 946 961 N/A INTRINSIC
low complexity region 1497 1508 N/A INTRINSIC
Pfam:TEX15 1572 1788 1.3e-109 PFAM
Pfam:TEX15 1901 2119 1.1e-16 PFAM
low complexity region 2758 2770 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124496
SMART Domains Protein: ENSMUSP00000120744
Gene: ENSMUSG00000009628

DomainStartEndE-ValueType
Pfam:DUF3715 89 251 1.6e-58 PFAM
low complexity region 536 548 N/A INTRINSIC
low complexity region 576 587 N/A INTRINSIC
low complexity region 798 810 N/A INTRINSIC
low complexity region 939 948 N/A INTRINSIC
low complexity region 987 999 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124501
SMART Domains Protein: ENSMUSP00000138070
Gene: ENSMUSG00000009628

DomainStartEndE-ValueType
Pfam:DUF3715 96 251 2.4e-52 PFAM
Meta Mutation Damage Score 0.1008 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (71/71)
MGI Phenotype Strain: 3526165
PHENOTYPE: Male mice are infertile due to arrest of meiosis stemming from failure to repair double-strand breaks. However, female mice are fertile. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik T A 11: 58,446,366 I94L possibly damaging Het
4931406P16Rik A T 7: 34,242,377 Y627* probably null Het
Actr3 A T 1: 125,395,137 D364E probably benign Het
Adra2c C T 5: 35,280,079 T65I probably damaging Het
Agap2 T A 10: 127,089,360 probably null Het
Ager T C 17: 34,598,754 V126A possibly damaging Het
Arhgap39 T C 15: 76,737,536 I288M probably benign Het
Arhgap45 A T 10: 80,026,234 S541C probably benign Het
Asb4 A G 6: 5,431,043 Y426C probably damaging Het
Azi2 C T 9: 118,049,338 T82I probably damaging Het
Baz2b T A 2: 59,948,223 R764S probably damaging Het
Ccdc146 A C 5: 21,301,340 I701S probably damaging Het
Cd55b T A 1: 130,418,166 I172F probably damaging Het
Cdk11b A G 4: 155,634,190 E199G probably benign Het
Cntnap4 A T 8: 112,752,289 T216S possibly damaging Het
D5Ertd579e A T 5: 36,604,514 N1336K possibly damaging Het
Dlg5 T C 14: 24,164,568 N649S probably damaging Het
Dmxl1 A G 18: 49,846,586 E96G probably benign Het
Dscaml1 C T 9: 45,668,160 T335I possibly damaging Het
Epb41l2 G T 10: 25,502,124 G695C probably damaging Het
Erbb4 C T 1: 68,560,576 R114H probably damaging Het
F2rl1 G T 13: 95,513,938 Y145* probably null Het
Fam58b T C 11: 78,751,230 K145E probably damaging Het
Fsip2 A T 2: 82,980,441 Y2368F possibly damaging Het
Galnt7 C T 8: 57,536,578 probably null Het
Gm6811 T A 17: 21,093,983 noncoding transcript Het
Gm6811 T G 17: 21,094,690 noncoding transcript Het
H2-M1 G A 17: 36,671,710 T86M possibly damaging Het
Hk2 T C 6: 82,743,366 D170G probably benign Het
Hmcn1 C T 1: 150,738,681 A1325T possibly damaging Het
Insrr T A 3: 87,800,519 Y89* probably null Het
Itga1 T C 13: 114,980,852 E871G probably benign Het
Kat6a T C 8: 22,939,405 L1592P possibly damaging Het
Kndc1 C A 7: 139,921,063 A756E probably benign Het
Krt12 A T 11: 99,421,902 C105* probably null Het
Lama1 G A 17: 67,784,088 probably null Het
Lama3 A G 18: 12,506,949 N67S probably benign Het
Lrrk1 A G 7: 66,306,839 probably null Het
Map2 T C 1: 66,399,419 V34A probably damaging Het
Mroh6 A G 15: 75,885,700 L487P probably damaging Het
Myo18b A T 5: 112,811,642 S1430T probably benign Het
Notch3 G A 17: 32,154,749 T495I probably benign Het
Olfr391-ps A T 11: 73,799,403 M118K probably damaging Het
Palld C T 8: 61,513,423 A980T probably damaging Het
Paxip1 A T 5: 27,761,668 I620N probably damaging Het
Pcdha6 A G 18: 36,969,767 probably null Het
Pcdhb11 G A 18: 37,421,760 V48M probably benign Het
Pcdhga6 A G 18: 37,707,644 E139G probably benign Het
Pck1 T C 2: 173,157,319 V426A probably damaging Het
Pck2 T A 14: 55,542,624 I110N probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phactr3 G A 2: 178,279,019 E222K probably damaging Het
Ppip5k1 A T 2: 121,323,203 probably benign Het
Prodh2 A G 7: 30,506,651 H278R probably benign Het
Rspry1 T A 8: 94,623,258 H91Q probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Smn1 A G 13: 100,127,995 N78S possibly damaging Het
Spta1 T A 1: 174,218,512 I1614N probably damaging Het
Syt17 T C 7: 118,434,290 D165G probably damaging Het
Tbck A G 3: 132,743,005 Y593C probably damaging Het
Tcaf2 G C 6: 42,629,753 F422L probably benign Het
Trpc4 A G 3: 54,318,020 E846G probably benign Het
Ttc41 T C 10: 86,744,449 I753T probably benign Het
Vdac1 C T 11: 52,376,482 T70M possibly damaging Het
Vmn1r124 A C 7: 21,260,179 F147V probably benign Het
Vmn1r220 T C 13: 23,184,295 D77G probably damaging Het
Vmn2r28 T C 7: 5,490,731 H72R probably benign Het
Vmn2r78 A T 7: 86,921,110 I279L probably benign Het
Vmn2r95 G T 17: 18,451,470 A490S possibly damaging Het
Wdfy4 C T 14: 33,109,525 A915T possibly damaging Het
Zmiz2 G T 11: 6,395,604 probably null Het
Zscan2 A G 7: 80,875,809 N426S probably benign Het
Other mutations in Tex15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Tex15 APN 8 33575311 missense probably benign 0.18
IGL00705:Tex15 APN 8 33581592 missense probably damaging 1.00
IGL00820:Tex15 APN 8 33579006 splice site probably benign
IGL01288:Tex15 APN 8 33571384 missense probably benign 0.02
IGL01328:Tex15 APN 8 33571396 nonsense probably null
IGL01359:Tex15 APN 8 33581898 missense probably damaging 0.99
IGL01603:Tex15 APN 8 33573547 missense possibly damaging 0.93
IGL01861:Tex15 APN 8 33570689 missense probably damaging 1.00
IGL02052:Tex15 APN 8 33582465 missense probably benign 0.28
IGL02560:Tex15 APN 8 33581751 missense probably benign 0.00
IGL02677:Tex15 APN 8 33571080 missense probably benign 0.03
IGL02739:Tex15 APN 8 33581693 missense possibly damaging 0.68
Big_gulp UTSW 8 33581734 missense probably damaging 1.00
P0005:Tex15 UTSW 8 33570868 missense probably benign 0.00
P0037:Tex15 UTSW 8 33581580 missense probably benign 0.00
PIT4377001:Tex15 UTSW 8 33571101 missense probably damaging 1.00
R0056:Tex15 UTSW 8 33582027 missense probably benign 0.00
R0056:Tex15 UTSW 8 33582027 missense probably benign 0.00
R0058:Tex15 UTSW 8 33581502 splice site probably benign
R0058:Tex15 UTSW 8 33581502 splice site probably benign
R0595:Tex15 UTSW 8 33572617 missense probably damaging 1.00
R0646:Tex15 UTSW 8 33582326 missense possibly damaging 0.83
R0688:Tex15 UTSW 8 33573500 missense probably damaging 1.00
R0842:Tex15 UTSW 8 33571547 missense possibly damaging 0.95
R0987:Tex15 UTSW 8 33576847 missense probably damaging 1.00
R1084:Tex15 UTSW 8 33577004 missense probably benign 0.28
R1183:Tex15 UTSW 8 33574865 missense probably benign 0.35
R1186:Tex15 UTSW 8 33571633 missense probably benign 0.19
R1378:Tex15 UTSW 8 33575216 missense probably damaging 0.99
R1500:Tex15 UTSW 8 33575092 missense probably damaging 0.96
R1508:Tex15 UTSW 8 33576852 missense probably damaging 1.00
R1597:Tex15 UTSW 8 33571483 missense probably damaging 0.96
R1636:Tex15 UTSW 8 33576387 nonsense probably null
R1639:Tex15 UTSW 8 33570817 missense possibly damaging 0.94
R1809:Tex15 UTSW 8 33574234 missense probably benign
R1843:Tex15 UTSW 8 33576654 missense probably benign 0.27
R2029:Tex15 UTSW 8 33571274 missense probably damaging 0.99
R2228:Tex15 UTSW 8 33571237 missense probably benign 0.05
R2229:Tex15 UTSW 8 33571237 missense probably benign 0.05
R2245:Tex15 UTSW 8 33571496 missense possibly damaging 0.77
R2246:Tex15 UTSW 8 33582512 missense possibly damaging 0.49
R2880:Tex15 UTSW 8 33574907 nonsense probably null
R2881:Tex15 UTSW 8 33574907 nonsense probably null
R2882:Tex15 UTSW 8 33574907 nonsense probably null
R3001:Tex15 UTSW 8 33574528 missense probably benign 0.15
R3002:Tex15 UTSW 8 33574528 missense probably benign 0.15
R3020:Tex15 UTSW 8 33576670 missense probably damaging 1.00
R3084:Tex15 UTSW 8 33574885 missense probably benign 0.11
R3085:Tex15 UTSW 8 33574885 missense probably benign 0.11
R3701:Tex15 UTSW 8 33574166 missense probably benign 0.00
R3702:Tex15 UTSW 8 33574166 missense probably benign 0.00
R3752:Tex15 UTSW 8 33571415 missense probably benign
R4162:Tex15 UTSW 8 33581558 missense probably damaging 1.00
R4231:Tex15 UTSW 8 33572137 missense probably damaging 0.99
R4589:Tex15 UTSW 8 33557373 missense probably damaging 1.00
R4707:Tex15 UTSW 8 33582497 missense probably benign 0.00
R4773:Tex15 UTSW 8 33582732 missense probably benign 0.42
R4967:Tex15 UTSW 8 33574470 missense probably benign 0.34
R5063:Tex15 UTSW 8 33582610 missense possibly damaging 0.59
R5121:Tex15 UTSW 8 33571766 missense probably damaging 1.00
R5147:Tex15 UTSW 8 33572312 nonsense probably null
R5166:Tex15 UTSW 8 33576392 missense probably benign 0.07
R5173:Tex15 UTSW 8 33571740 missense possibly damaging 0.73
R5439:Tex15 UTSW 8 33574171 missense possibly damaging 0.93
R5537:Tex15 UTSW 8 33571613 missense probably damaging 1.00
R5580:Tex15 UTSW 8 33572429 missense probably damaging 1.00
R5588:Tex15 UTSW 8 33577187 missense probably damaging 1.00
R5696:Tex15 UTSW 8 33573192 missense probably benign 0.01
R5734:Tex15 UTSW 8 33546336 missense probably benign 0.01
R5756:Tex15 UTSW 8 33575833 missense probably benign 0.17
R5823:Tex15 UTSW 8 33570934 missense possibly damaging 0.67
R6126:Tex15 UTSW 8 33573563 missense probably benign 0.19
R6129:Tex15 UTSW 8 33574130 missense possibly damaging 0.90
R6374:Tex15 UTSW 8 33575912 missense probably damaging 1.00
R6430:Tex15 UTSW 8 33571301 missense probably benign 0.01
R6452:Tex15 UTSW 8 33572816 missense probably damaging 1.00
R6471:Tex15 UTSW 8 33581734 missense probably damaging 1.00
R6700:Tex15 UTSW 8 33574889 missense possibly damaging 0.93
R6918:Tex15 UTSW 8 33573184 missense probably benign 0.27
R6958:Tex15 UTSW 8 33570871 missense probably benign 0.01
R6970:Tex15 UTSW 8 33557428 missense probably benign 0.03
R7059:Tex15 UTSW 8 33574730 missense possibly damaging 0.57
R7069:Tex15 UTSW 8 33570720 missense probably benign
R7072:Tex15 UTSW 8 33575431 missense possibly damaging 0.85
R7212:Tex15 UTSW 8 33570826 nonsense probably null
R7212:Tex15 UTSW 8 33572995 missense probably damaging 1.00
R7216:Tex15 UTSW 8 33572986 missense possibly damaging 0.93
R7219:Tex15 UTSW 8 33546240 missense probably benign 0.40
R7313:Tex15 UTSW 8 33574817 missense possibly damaging 0.82
R7315:Tex15 UTSW 8 33581516 missense probably benign 0.01
X0020:Tex15 UTSW 8 33576579 missense probably benign 0.03
X0065:Tex15 UTSW 8 33575517 nonsense probably null
Z1088:Tex15 UTSW 8 33571315 missense possibly damaging 0.89
Z1088:Tex15 UTSW 8 33571810 missense possibly damaging 0.68
Z1088:Tex15 UTSW 8 33574870 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCCTTAAGAAAGAGCTGGCTG -3'
(R):5'- GCAAAGCATTCCTTTTGTTGCG -3'

Sequencing Primer
(F):5'- CCTTAAGAAAGAGCTGGCTGTTATC -3'
(R):5'- CGCAGCATTTGGAGAAAGAG -3'
Posted On2018-03-15