Incidental Mutation 'R6276:Vdac1'
ID507659
Institutional Source Beutler Lab
Gene Symbol Vdac1
Ensembl Gene ENSMUSG00000020402
Gene Namevoltage-dependent anion channel 1
SynonymsVdac5
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.621) question?
Stock #R6276 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location52360860-52389397 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 52376482 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 70 (T70M)
Ref Sequence ENSEMBL: ENSMUSP00000116919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020673] [ENSMUST00000102758] [ENSMUST00000125694]
Predicted Effect probably benign
Transcript: ENSMUST00000020673
AA Change: T83M

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000020673
Gene: ENSMUSG00000020402
AA Change: T83M

DomainStartEndE-ValueType
Pfam:Porin_3 16 289 1.7e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102758
AA Change: T70M

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099819
Gene: ENSMUSG00000020402
AA Change: T70M

DomainStartEndE-ValueType
Pfam:Porin_3 3 276 7.6e-80 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000125694
AA Change: T70M

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116919
Gene: ENSMUSG00000020402
AA Change: T70M

DomainStartEndE-ValueType
Pfam:Porin_3 3 235 1.7e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157052
Meta Mutation Damage Score 0.436 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: This gene encodes a voltage-dependent anion channel protein that is a major component of the outer mitochondrial membrane. The encoded protein facilitates the exchange of metabolites and ions across the outer mitochondrial membrane and may regulate mitochondrial functions. This protein also forms channels in the plasma membrane and may be involved in transmembrane electron transport. Multiple pseudogenes of this gene are found on chromosomes 1, 2, 3, 6, 8, 9, and X. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mutants exhibit approximately 60% embryonic mortality, with loss occurring at embryonic day 10.5-11.5. Survivors exhibit defective cued fear conditioning and spatial learning. Heterozygotes also exhibit about 12% prenatal mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik T A 11: 58,446,366 I94L possibly damaging Het
4931406P16Rik A T 7: 34,242,377 Y627* probably null Het
Actr3 A T 1: 125,395,137 D364E probably benign Het
Adra2c C T 5: 35,280,079 T65I probably damaging Het
Agap2 T A 10: 127,089,360 probably null Het
Ager T C 17: 34,598,754 V126A possibly damaging Het
Arhgap39 T C 15: 76,737,536 I288M probably benign Het
Arhgap45 A T 10: 80,026,234 S541C probably benign Het
Asb4 A G 6: 5,431,043 Y426C probably damaging Het
Azi2 C T 9: 118,049,338 T82I probably damaging Het
Baz2b T A 2: 59,948,223 R764S probably damaging Het
Ccdc146 A C 5: 21,301,340 I701S probably damaging Het
Cd55b T A 1: 130,418,166 I172F probably damaging Het
Cdk11b A G 4: 155,634,190 E199G probably benign Het
Cntnap4 A T 8: 112,752,289 T216S possibly damaging Het
D5Ertd579e A T 5: 36,604,514 N1336K possibly damaging Het
Dlg5 T C 14: 24,164,568 N649S probably damaging Het
Dmxl1 A G 18: 49,846,586 E96G probably benign Het
Dscaml1 C T 9: 45,668,160 T335I possibly damaging Het
Epb41l2 G T 10: 25,502,124 G695C probably damaging Het
Erbb4 C T 1: 68,560,576 R114H probably damaging Het
F2rl1 G T 13: 95,513,938 Y145* probably null Het
Fam58b T C 11: 78,751,230 K145E probably damaging Het
Fsip2 A T 2: 82,980,441 Y2368F possibly damaging Het
Galnt7 C T 8: 57,536,578 probably null Het
Gm6811 T A 17: 21,093,983 noncoding transcript Het
Gm6811 T G 17: 21,094,690 noncoding transcript Het
H2-M1 G A 17: 36,671,710 T86M possibly damaging Het
Hk2 T C 6: 82,743,366 D170G probably benign Het
Hmcn1 C T 1: 150,738,681 A1325T possibly damaging Het
Insrr T A 3: 87,800,519 Y89* probably null Het
Itga1 T C 13: 114,980,852 E871G probably benign Het
Kat6a T C 8: 22,939,405 L1592P possibly damaging Het
Kndc1 C A 7: 139,921,063 A756E probably benign Het
Krt12 A T 11: 99,421,902 C105* probably null Het
Lama1 G A 17: 67,784,088 probably null Het
Lama3 A G 18: 12,506,949 N67S probably benign Het
Lrrk1 A G 7: 66,306,839 probably null Het
Map2 T C 1: 66,399,419 V34A probably damaging Het
Mroh6 A G 15: 75,885,700 L487P probably damaging Het
Myo18b A T 5: 112,811,642 S1430T probably benign Het
Notch3 G A 17: 32,154,749 T495I probably benign Het
Olfr391-ps A T 11: 73,799,403 M118K probably damaging Het
Palld C T 8: 61,513,423 A980T probably damaging Het
Paxip1 A T 5: 27,761,668 I620N probably damaging Het
Pcdha6 A G 18: 36,969,767 probably null Het
Pcdhb11 G A 18: 37,421,760 V48M probably benign Het
Pcdhga6 A G 18: 37,707,644 E139G probably benign Het
Pck1 T C 2: 173,157,319 V426A probably damaging Het
Pck2 T A 14: 55,542,624 I110N probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phactr3 G A 2: 178,279,019 E222K probably damaging Het
Ppip5k1 A T 2: 121,323,203 probably benign Het
Prodh2 A G 7: 30,506,651 H278R probably benign Het
Rspry1 T A 8: 94,623,258 H91Q probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Smn1 A G 13: 100,127,995 N78S possibly damaging Het
Spta1 T A 1: 174,218,512 I1614N probably damaging Het
Syt17 T C 7: 118,434,290 D165G probably damaging Het
Tbck A G 3: 132,743,005 Y593C probably damaging Het
Tcaf2 G C 6: 42,629,753 F422L probably benign Het
Tex15 T A 8: 33,577,189 F2216I possibly damaging Het
Trpc4 A G 3: 54,318,020 E846G probably benign Het
Ttc41 T C 10: 86,744,449 I753T probably benign Het
Vmn1r124 A C 7: 21,260,179 F147V probably benign Het
Vmn1r220 T C 13: 23,184,295 D77G probably damaging Het
Vmn2r28 T C 7: 5,490,731 H72R probably benign Het
Vmn2r78 A T 7: 86,921,110 I279L probably benign Het
Vmn2r95 G T 17: 18,451,470 A490S possibly damaging Het
Wdfy4 C T 14: 33,109,525 A915T possibly damaging Het
Zmiz2 G T 11: 6,395,604 probably null Het
Zscan2 A G 7: 80,875,809 N426S probably benign Het
Other mutations in Vdac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01350:Vdac1 APN 11 52385662 missense probably benign 0.02
IGL02057:Vdac1 APN 11 52376544 critical splice donor site probably null
IGL03223:Vdac1 APN 11 52376655 missense probably benign
IGL03225:Vdac1 APN 11 52376655 missense probably benign
R0362:Vdac1 UTSW 11 52374973 splice site probably benign
R1612:Vdac1 UTSW 11 52384070 missense probably benign 0.03
R1694:Vdac1 UTSW 11 52374363 missense probably damaging 0.96
R2512:Vdac1 UTSW 11 52384077 missense probably damaging 1.00
R3717:Vdac1 UTSW 11 52376646 critical splice acceptor site probably null
R4592:Vdac1 UTSW 11 52374972 splice site probably null
R5027:Vdac1 UTSW 11 52388478 missense possibly damaging 0.75
R5209:Vdac1 UTSW 11 52376452 missense probably damaging 0.99
R5256:Vdac1 UTSW 11 52384078 critical splice donor site probably null
R5413:Vdac1 UTSW 11 52374967 missense probably null 0.17
R5762:Vdac1 UTSW 11 52387453 missense possibly damaging 0.77
R6954:Vdac1 UTSW 11 52386373 missense probably damaging 1.00
R7023:Vdac1 UTSW 11 52374366 missense probably damaging 0.99
R7261:Vdac1 UTSW 11 52374934 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGACTCTCTGTTGCTTAAGGGC -3'
(R):5'- GAGAACCTTACCCAGTGTTCG -3'

Sequencing Primer
(F):5'- TTGCTTAAGGGCCTGGACCAAG -3'
(R):5'- TCAAAGGTGAGCTTCAGTCC -3'
Posted On2018-03-15