Incidental Mutation 'R6276:Smn1'
ID507667
Institutional Source Beutler Lab
Gene Symbol Smn1
Ensembl Gene ENSMUSG00000021645
Gene Namesurvival motor neuron 1
SynonymsSMN
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6276 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location100124852-100137690 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100127995 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 78 (N78S)
Ref Sequence ENSEMBL: ENSMUSP00000119381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022147] [ENSMUST00000091321] [ENSMUST00000140745] [ENSMUST00000143937]
Predicted Effect probably benign
Transcript: ENSMUST00000022147
AA Change: N152S

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000022147
Gene: ENSMUSG00000021645
AA Change: N152S

DomainStartEndE-ValueType
PDB:3S6N|M 23 59 3e-18 PDB
low complexity region 70 82 N/A INTRINSIC
TUDOR 87 146 7.06e-17 SMART
low complexity region 188 246 N/A INTRINSIC
PDB:4GLI|A 247 287 1e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000091321
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134514
Predicted Effect probably benign
Transcript: ENSMUST00000140745
Predicted Effect possibly damaging
Transcript: ENSMUST00000143937
AA Change: N78S

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000119381
Gene: ENSMUSG00000021645
AA Change: N78S

DomainStartEndE-ValueType
TUDOR 13 72 6.15e-17 SMART
low complexity region 114 158 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147306
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151389
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (71/71)
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit cell loss and peri-implantation lethality. Muscle-specific KO mice show muscle necrosis leading to paralysis and death. Neuron-specific KO mice show muscle degeneration associated with loss of motor axons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik T A 11: 58,446,366 I94L possibly damaging Het
4931406P16Rik A T 7: 34,242,377 Y627* probably null Het
Actr3 A T 1: 125,395,137 D364E probably benign Het
Adra2c C T 5: 35,280,079 T65I probably damaging Het
Agap2 T A 10: 127,089,360 probably null Het
Ager T C 17: 34,598,754 V126A possibly damaging Het
Arhgap39 T C 15: 76,737,536 I288M probably benign Het
Arhgap45 A T 10: 80,026,234 S541C probably benign Het
Asb4 A G 6: 5,431,043 Y426C probably damaging Het
Azi2 C T 9: 118,049,338 T82I probably damaging Het
Baz2b T A 2: 59,948,223 R764S probably damaging Het
Ccdc146 A C 5: 21,301,340 I701S probably damaging Het
Cd55b T A 1: 130,418,166 I172F probably damaging Het
Cdk11b A G 4: 155,634,190 E199G probably benign Het
Cntnap4 A T 8: 112,752,289 T216S possibly damaging Het
D5Ertd579e A T 5: 36,604,514 N1336K possibly damaging Het
Dlg5 T C 14: 24,164,568 N649S probably damaging Het
Dmxl1 A G 18: 49,846,586 E96G probably benign Het
Dscaml1 C T 9: 45,668,160 T335I possibly damaging Het
Epb41l2 G T 10: 25,502,124 G695C probably damaging Het
Erbb4 C T 1: 68,560,576 R114H probably damaging Het
F2rl1 G T 13: 95,513,938 Y145* probably null Het
Fam58b T C 11: 78,751,230 K145E probably damaging Het
Fsip2 A T 2: 82,980,441 Y2368F possibly damaging Het
Galnt7 C T 8: 57,536,578 probably null Het
Gm6811 T A 17: 21,093,983 noncoding transcript Het
Gm6811 T G 17: 21,094,690 noncoding transcript Het
H2-M1 G A 17: 36,671,710 T86M possibly damaging Het
Hk2 T C 6: 82,743,366 D170G probably benign Het
Hmcn1 C T 1: 150,738,681 A1325T possibly damaging Het
Insrr T A 3: 87,800,519 Y89* probably null Het
Itga1 T C 13: 114,980,852 E871G probably benign Het
Kat6a T C 8: 22,939,405 L1592P possibly damaging Het
Kndc1 C A 7: 139,921,063 A756E probably benign Het
Krt12 A T 11: 99,421,902 C105* probably null Het
Lama1 G A 17: 67,784,088 probably null Het
Lama3 A G 18: 12,506,949 N67S probably benign Het
Lrrk1 A G 7: 66,306,839 probably null Het
Map2 T C 1: 66,399,419 V34A probably damaging Het
Mroh6 A G 15: 75,885,700 L487P probably damaging Het
Myo18b A T 5: 112,811,642 S1430T probably benign Het
Notch3 G A 17: 32,154,749 T495I probably benign Het
Olfr391-ps A T 11: 73,799,403 M118K probably damaging Het
Palld C T 8: 61,513,423 A980T probably damaging Het
Paxip1 A T 5: 27,761,668 I620N probably damaging Het
Pcdha6 A G 18: 36,969,767 probably null Het
Pcdhb11 G A 18: 37,421,760 V48M probably benign Het
Pcdhga6 A G 18: 37,707,644 E139G probably benign Het
Pck1 T C 2: 173,157,319 V426A probably damaging Het
Pck2 T A 14: 55,542,624 I110N probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phactr3 G A 2: 178,279,019 E222K probably damaging Het
Ppip5k1 A T 2: 121,323,203 probably benign Het
Prodh2 A G 7: 30,506,651 H278R probably benign Het
Rspry1 T A 8: 94,623,258 H91Q probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Spta1 T A 1: 174,218,512 I1614N probably damaging Het
Syt17 T C 7: 118,434,290 D165G probably damaging Het
Tbck A G 3: 132,743,005 Y593C probably damaging Het
Tcaf2 G C 6: 42,629,753 F422L probably benign Het
Tex15 T A 8: 33,577,189 F2216I possibly damaging Het
Trpc4 A G 3: 54,318,020 E846G probably benign Het
Ttc41 T C 10: 86,744,449 I753T probably benign Het
Vdac1 C T 11: 52,376,482 T70M possibly damaging Het
Vmn1r124 A C 7: 21,260,179 F147V probably benign Het
Vmn1r220 T C 13: 23,184,295 D77G probably damaging Het
Vmn2r28 T C 7: 5,490,731 H72R probably benign Het
Vmn2r78 A T 7: 86,921,110 I279L probably benign Het
Vmn2r95 G T 17: 18,451,470 A490S possibly damaging Het
Wdfy4 C T 14: 33,109,525 A915T possibly damaging Het
Zmiz2 G T 11: 6,395,604 probably null Het
Zscan2 A G 7: 80,875,809 N426S probably benign Het
Other mutations in Smn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02377:Smn1 APN 13 100135684 unclassified probably benign
IGL02932:Smn1 APN 13 100127964 missense probably benign 0.40
IGL03325:Smn1 APN 13 100127857 missense probably damaging 1.00
R0907:Smn1 UTSW 13 100127896 missense probably damaging 0.99
R1573:Smn1 UTSW 13 100126610 missense probably damaging 1.00
R1629:Smn1 UTSW 13 100127896 missense probably damaging 1.00
R4898:Smn1 UTSW 13 100132423 missense probably damaging 1.00
R5082:Smn1 UTSW 13 100137382 splice site probably benign
R5902:Smn1 UTSW 13 100126904 missense probably benign 0.00
R6481:Smn1 UTSW 13 100128500 unclassified probably null
R6758:Smn1 UTSW 13 100132438 missense possibly damaging 0.88
R7114:Smn1 UTSW 13 100131140 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGAATGTTGCGTGTCCATAAC -3'
(R):5'- CGACAAGCATTCCTATGGCC -3'

Sequencing Primer
(F):5'- TGGTGACAAGTGTTCTGCTG -3'
(R):5'- AGCATTCCTATGGCCCCGAC -3'
Posted On2018-03-15