Incidental Mutation 'R6276:Pcdhb11'
ID507683
Institutional Source Beutler Lab
Gene Symbol Pcdhb11
Ensembl Gene ENSMUSG00000051486
Gene Nameprotocadherin beta 11
SynonymsPcdhb5E, PcdhbK
MMRRC Submission
Accession Numbers

Genbank: NM_053136.3; Ensembl: ENSMUST00000053073

Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R6276 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37421418-37425836 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 37421760 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 48 (V48M)
Ref Sequence ENSEMBL: ENSMUSP00000056148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053073] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000053073
AA Change: V48M

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000056148
Gene: ENSMUSG00000051486
AA Change: V48M

DomainStartEndE-ValueType
CA 54 131 3.51e-1 SMART
CA 155 240 4.11e-21 SMART
CA 264 344 6.37e-27 SMART
CA 367 448 4.79e-22 SMART
CA 472 558 7.31e-27 SMART
CA 588 669 2.46e-10 SMART
Pfam:Cadherin_C_2 686 769 3.4e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik T A 11: 58,446,366 I94L possibly damaging Het
4931406P16Rik A T 7: 34,242,377 Y627* probably null Het
Actr3 A T 1: 125,395,137 D364E probably benign Het
Adra2c C T 5: 35,280,079 T65I probably damaging Het
Agap2 T A 10: 127,089,360 probably null Het
Ager T C 17: 34,598,754 V126A possibly damaging Het
Arhgap39 T C 15: 76,737,536 I288M probably benign Het
Arhgap45 A T 10: 80,026,234 S541C probably benign Het
Asb4 A G 6: 5,431,043 Y426C probably damaging Het
Azi2 C T 9: 118,049,338 T82I probably damaging Het
Baz2b T A 2: 59,948,223 R764S probably damaging Het
Ccdc146 A C 5: 21,301,340 I701S probably damaging Het
Cd55b T A 1: 130,418,166 I172F probably damaging Het
Cdk11b A G 4: 155,634,190 E199G probably benign Het
Cntnap4 A T 8: 112,752,289 T216S possibly damaging Het
D5Ertd579e A T 5: 36,604,514 N1336K possibly damaging Het
Dlg5 T C 14: 24,164,568 N649S probably damaging Het
Dmxl1 A G 18: 49,846,586 E96G probably benign Het
Dscaml1 C T 9: 45,668,160 T335I possibly damaging Het
Epb41l2 G T 10: 25,502,124 G695C probably damaging Het
Erbb4 C T 1: 68,560,576 R114H probably damaging Het
F2rl1 G T 13: 95,513,938 Y145* probably null Het
Fam58b T C 11: 78,751,230 K145E probably damaging Het
Fsip2 A T 2: 82,980,441 Y2368F possibly damaging Het
Galnt7 C T 8: 57,536,578 probably null Het
Gm6811 T A 17: 21,093,983 noncoding transcript Het
Gm6811 T G 17: 21,094,690 noncoding transcript Het
H2-M1 G A 17: 36,671,710 T86M possibly damaging Het
Hk2 T C 6: 82,743,366 D170G probably benign Het
Hmcn1 C T 1: 150,738,681 A1325T possibly damaging Het
Insrr T A 3: 87,800,519 Y89* probably null Het
Itga1 T C 13: 114,980,852 E871G probably benign Het
Kat6a T C 8: 22,939,405 L1592P possibly damaging Het
Kndc1 C A 7: 139,921,063 A756E probably benign Het
Krt12 A T 11: 99,421,902 C105* probably null Het
Lama1 G A 17: 67,784,088 probably null Het
Lama3 A G 18: 12,506,949 N67S probably benign Het
Lrrk1 A G 7: 66,306,839 probably null Het
Map2 T C 1: 66,399,419 V34A probably damaging Het
Mroh6 A G 15: 75,885,700 L487P probably damaging Het
Myo18b A T 5: 112,811,642 S1430T probably benign Het
Notch3 G A 17: 32,154,749 T495I probably benign Het
Olfr391-ps A T 11: 73,799,403 M118K probably damaging Het
Palld C T 8: 61,513,423 A980T probably damaging Het
Paxip1 A T 5: 27,761,668 I620N probably damaging Het
Pcdha6 A G 18: 36,969,767 probably null Het
Pcdhga6 A G 18: 37,707,644 E139G probably benign Het
Pck1 T C 2: 173,157,319 V426A probably damaging Het
Pck2 T A 14: 55,542,624 I110N probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phactr3 G A 2: 178,279,019 E222K probably damaging Het
Ppip5k1 A T 2: 121,323,203 probably benign Het
Prodh2 A G 7: 30,506,651 H278R probably benign Het
Rspry1 T A 8: 94,623,258 H91Q probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Smn1 A G 13: 100,127,995 N78S possibly damaging Het
Spta1 T A 1: 174,218,512 I1614N probably damaging Het
Syt17 T C 7: 118,434,290 D165G probably damaging Het
Tbck A G 3: 132,743,005 Y593C probably damaging Het
Tcaf2 G C 6: 42,629,753 F422L probably benign Het
Tex15 T A 8: 33,577,189 F2216I possibly damaging Het
Trpc4 A G 3: 54,318,020 E846G probably benign Het
Ttc41 T C 10: 86,744,449 I753T probably benign Het
Vdac1 C T 11: 52,376,482 T70M possibly damaging Het
Vmn1r124 A C 7: 21,260,179 F147V probably benign Het
Vmn1r220 T C 13: 23,184,295 D77G probably damaging Het
Vmn2r28 T C 7: 5,490,731 H72R probably benign Het
Vmn2r78 A T 7: 86,921,110 I279L probably benign Het
Vmn2r95 G T 17: 18,451,470 A490S possibly damaging Het
Wdfy4 C T 14: 33,109,525 A915T possibly damaging Het
Zmiz2 G T 11: 6,395,604 probably null Het
Zscan2 A G 7: 80,875,809 N426S probably benign Het
Other mutations in Pcdhb11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Pcdhb11 APN 18 37421973 missense probably benign 0.00
IGL00906:Pcdhb11 APN 18 37422121 missense possibly damaging 0.67
IGL01610:Pcdhb11 APN 18 37423359 missense probably benign 0.00
IGL01973:Pcdhb11 APN 18 37423512 missense probably damaging 1.00
IGL01977:Pcdhb11 APN 18 37422291 missense possibly damaging 0.49
IGL02164:Pcdhb11 APN 18 37423359 missense probably benign 0.00
IGL02282:Pcdhb11 APN 18 37423828 missense probably damaging 1.00
IGL02674:Pcdhb11 APN 18 37423614 missense probably damaging 1.00
IGL02965:Pcdhb11 APN 18 37423968 missense probably benign
IGL03197:Pcdhb11 APN 18 37422424 nonsense probably null
1mM(1):Pcdhb11 UTSW 18 37423957 missense probably benign 0.00
R0001:Pcdhb11 UTSW 18 37423989 missense probably benign 0.06
R0383:Pcdhb11 UTSW 18 37423393 missense probably damaging 1.00
R0421:Pcdhb11 UTSW 18 37422480 missense probably benign 0.04
R0422:Pcdhb11 UTSW 18 37421870 missense probably damaging 1.00
R0427:Pcdhb11 UTSW 18 37422765 missense probably damaging 1.00
R0542:Pcdhb11 UTSW 18 37423834 missense probably damaging 1.00
R0620:Pcdhb11 UTSW 18 37421811 nonsense probably null
R1014:Pcdhb11 UTSW 18 37423369 missense probably damaging 1.00
R1277:Pcdhb11 UTSW 18 37421716 missense possibly damaging 0.79
R2034:Pcdhb11 UTSW 18 37422493 missense probably benign 0.00
R2142:Pcdhb11 UTSW 18 37422123 missense probably benign 0.28
R2496:Pcdhb11 UTSW 18 37422322 missense probably benign 0.30
R3077:Pcdhb11 UTSW 18 37422244 missense probably benign 0.08
R4560:Pcdhb11 UTSW 18 37423734 missense possibly damaging 0.61
R4590:Pcdhb11 UTSW 18 37422496 missense probably damaging 0.98
R4642:Pcdhb11 UTSW 18 37421968 missense probably benign 0.01
R4729:Pcdhb11 UTSW 18 37422366 nonsense probably null
R5012:Pcdhb11 UTSW 18 37422976 missense possibly damaging 0.48
R5364:Pcdhb11 UTSW 18 37422179 missense probably benign 0.06
R5910:Pcdhb11 UTSW 18 37423743 missense probably benign 0.43
R6023:Pcdhb11 UTSW 18 37422925 missense possibly damaging 0.94
R6106:Pcdhb11 UTSW 18 37423003 missense probably damaging 1.00
R6254:Pcdhb11 UTSW 18 37421718 missense probably damaging 0.99
R6360:Pcdhb11 UTSW 18 37422159 missense probably benign
R6699:Pcdhb11 UTSW 18 37422937 missense probably damaging 1.00
R6732:Pcdhb11 UTSW 18 37422144 missense probably benign
R6760:Pcdhb11 UTSW 18 37421584 intron probably benign
R6916:Pcdhb11 UTSW 18 37422381 missense possibly damaging 0.52
R7130:Pcdhb11 UTSW 18 37423506 missense probably benign 0.04
R7267:Pcdhb11 UTSW 18 37421953 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- GTGGACTGTAATCAACCAGAAGC -3'
(R):5'- GAACTGCACAGGGTTTTCCAG -3'

Sequencing Primer
(F):5'- GAAGCAGCAGCACCCTCTG -3'
(R):5'- GCACAGGGTTTTCCAGTATGACC -3'
Posted On2018-03-15