Incidental Mutation 'R6278:Olfr998'
ID507761
Institutional Source Beutler Lab
Gene Symbol Olfr998
Ensembl Gene ENSMUSG00000111454
Gene Nameolfactory receptor 998
SynonymsGA_x6K02T2Q125-47069356-47070300, MOR175-5
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.281) question?
Stock #R6278 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location85588948-85591893 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85590998 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 153 (I153V)
Ref Sequence ENSEMBL: ENSMUSP00000150713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052307] [ENSMUST00000215083]
Predicted Effect probably benign
Transcript: ENSMUST00000052307
AA Change: I153V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000059970
Gene: ENSMUSG00000111454
AA Change: I153V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.6e-54 PFAM
Pfam:7tm_1 41 308 9.5e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117353
Predicted Effect probably benign
Transcript: ENSMUST00000215083
AA Change: I153V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 T C 7: 119,773,849 S192P probably damaging Het
Amy1 T A 3: 113,561,690 Y348F probably damaging Het
Brpf3 C A 17: 28,821,284 P893H probably benign Het
Cage1 T C 13: 38,016,419 T702A possibly damaging Het
Cdk11b A G 4: 155,649,603 probably benign Het
Cdk5rap3 T C 11: 96,911,903 Y207C probably damaging Het
Cenpc1 T C 5: 86,035,535 K465R probably damaging Het
Cldn14 A C 16: 93,919,598 L120R possibly damaging Het
Cyp2c69 A T 19: 39,843,063 C435* probably null Het
Dmxl2 T A 9: 54,415,762 E1446V probably damaging Het
Dnah17 T A 11: 118,126,290 D208V probably damaging Het
Eif4g3 G T 4: 138,188,083 G1430V possibly damaging Het
Eif5 T A 12: 111,542,793 D284E probably benign Het
Fam47e T C 5: 92,562,517 L125P probably damaging Het
Far1 A G 7: 113,568,137 I476M probably benign Het
Fsip2 A T 2: 82,988,898 I4992L probably benign Het
Gli3 T A 13: 15,725,113 N1028K possibly damaging Het
Gm13128 C T 4: 144,330,267 P7S probably damaging Het
Gucy1a1 T C 3: 82,097,634 K615E probably damaging Het
Gykl1 G T 18: 52,695,208 S496I probably benign Het
Hmcn1 C T 1: 150,697,419 probably null Het
Itga2 T A 13: 114,845,888 H1027L probably benign Het
Kif24 A T 4: 41,423,498 V251E probably damaging Het
Nupr1 T C 7: 126,625,346 Y30C probably damaging Het
Olfr1137 A T 2: 87,711,471 L145* probably null Het
Olfr1475 T A 19: 13,479,755 M148L probably benign Het
Olfr943 T A 9: 39,184,298 I40N probably damaging Het
P2ry1 T A 3: 61,003,794 I118N possibly damaging Het
Pcdh1 C T 18: 38,199,210 V247M probably benign Het
Pdia5 A G 16: 35,429,923 V222A possibly damaging Het
Plce1 G A 19: 38,725,051 probably null Het
Ppm1m T C 9: 106,197,228 R239G probably damaging Het
Prkcz A T 4: 155,268,195 F492I probably damaging Het
Rpl6 T C 5: 121,208,849 I269T possibly damaging Het
Scoc T C 8: 83,458,336 S2G unknown Het
Spesp1 A T 9: 62,272,639 M329K probably benign Het
Ston2 T C 12: 91,648,330 K435E probably damaging Het
Synj2 A T 17: 5,975,874 L69F probably damaging Het
Tigd5 T C 15: 75,909,993 I68T probably damaging Het
Tmcc2 A T 1: 132,358,982 M577K probably damaging Het
Tmem131l A T 3: 83,942,491 I263N possibly damaging Het
Trip13 T C 13: 73,913,320 E408G probably benign Het
Txnl4b T C 8: 109,569,103 probably null Het
Ube2o T C 11: 116,539,543 E1123G probably damaging Het
Vmn1r123 A G 7: 21,162,849 H222R possibly damaging Het
Vmn2r73 G T 7: 85,872,932 H66Q probably benign Het
Zc3h13 T A 14: 75,330,423 V1052D probably benign Het
Other mutations in Olfr998
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01763:Olfr998 APN 2 85591347 missense probably benign 0.00
R0091:Olfr998 UTSW 2 85591352 missense probably benign 0.38
R0241:Olfr998 UTSW 2 85590810 missense probably benign 0.20
R0241:Olfr998 UTSW 2 85590810 missense probably benign 0.20
R0268:Olfr998 UTSW 2 85591301 missense possibly damaging 0.78
R0481:Olfr998 UTSW 2 85591104 missense possibly damaging 0.94
R1816:Olfr998 UTSW 2 85590925 missense probably benign 0.00
R1988:Olfr998 UTSW 2 85590641 missense probably benign 0.00
R2008:Olfr998 UTSW 2 85591422 missense probably damaging 1.00
R2060:Olfr998 UTSW 2 85591283 missense possibly damaging 0.78
R2273:Olfr998 UTSW 2 85590588 missense probably damaging 1.00
R4409:Olfr998 UTSW 2 85590930 missense probably damaging 1.00
R4783:Olfr998 UTSW 2 85590938 missense probably benign 0.03
R4785:Olfr998 UTSW 2 85590938 missense probably benign 0.03
R5098:Olfr998 UTSW 2 85590632 missense probably benign 0.00
R5176:Olfr998 UTSW 2 85591435 missense possibly damaging 0.88
R5462:Olfr998 UTSW 2 85591296 missense probably damaging 1.00
R6092:Olfr998 UTSW 2 85590606 missense probably benign 0.14
R7022:Olfr998 UTSW 2 85590598 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCCATAGCTCCTAAGATGCTCTG -3'
(R):5'- CACTCCTATGGCTCCAGAAAG -3'

Sequencing Primer
(F):5'- GAAAAGGATCTCTTTCATGGGC -3'
(R):5'- TATGGCTCCAGAAAGAACAAAAAGC -3'
Posted On2018-03-15