Incidental Mutation 'R6278:Gucy1a1'
ID507764
Institutional Source Beutler Lab
Gene Symbol Gucy1a1
Ensembl Gene ENSMUSG00000033910
Gene Nameguanylate cyclase 1, soluble, alpha 1
SynonymssGC-alpha1, alpha 1 sGC, 1200016O07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R6278 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location82092427-82145789 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82097634 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 615 (K615E)
Ref Sequence ENSEMBL: ENSMUSP00000142138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048976] [ENSMUST00000193924]
Predicted Effect probably damaging
Transcript: ENSMUST00000048976
AA Change: K615E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048918
Gene: ENSMUSG00000033910
AA Change: K615E

DomainStartEndE-ValueType
Pfam:HNOB 85 235 2.5e-8 PFAM
PDB:4GJ4|D 277 403 1e-18 PDB
CYCc 445 636 4.71e-103 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192289
Predicted Effect probably damaging
Transcript: ENSMUST00000193924
AA Change: K615E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142138
Gene: ENSMUSG00000033910
AA Change: K615E

DomainStartEndE-ValueType
Pfam:HNOB 73 237 1.6e-7 PFAM
PDB:4GJ4|D 277 403 1e-18 PDB
CYCc 445 636 4.71e-103 SMART
Meta Mutation Damage Score 0.032 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Soluble guanylate cyclases are heterodimeric proteins that catalyze the conversion of GTP to 3',5'-cyclic GMP and pyrophosphate. The protein encoded by this gene is an alpha subunit of this complex and it interacts with a beta subunit to form the guanylate cyclase enzyme, which is activated by nitric oxide. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null mutation display mild elevation of systolic blood pressure, and abnormal blood vessel and platelet responses to NO. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 T C 7: 119,773,849 S192P probably damaging Het
Amy1 T A 3: 113,561,690 Y348F probably damaging Het
Brpf3 C A 17: 28,821,284 P893H probably benign Het
Cage1 T C 13: 38,016,419 T702A possibly damaging Het
Cdk11b A G 4: 155,649,603 probably benign Het
Cdk5rap3 T C 11: 96,911,903 Y207C probably damaging Het
Cenpc1 T C 5: 86,035,535 K465R probably damaging Het
Cldn14 A C 16: 93,919,598 L120R possibly damaging Het
Cyp2c69 A T 19: 39,843,063 C435* probably null Het
Dmxl2 T A 9: 54,415,762 E1446V probably damaging Het
Dnah17 T A 11: 118,126,290 D208V probably damaging Het
Eif4g3 G T 4: 138,188,083 G1430V possibly damaging Het
Eif5 T A 12: 111,542,793 D284E probably benign Het
Fam47e T C 5: 92,562,517 L125P probably damaging Het
Far1 A G 7: 113,568,137 I476M probably benign Het
Fsip2 A T 2: 82,988,898 I4992L probably benign Het
Gli3 T A 13: 15,725,113 N1028K possibly damaging Het
Gm13128 C T 4: 144,330,267 P7S probably damaging Het
Gykl1 G T 18: 52,695,208 S496I probably benign Het
Hmcn1 C T 1: 150,697,419 probably null Het
Itga2 T A 13: 114,845,888 H1027L probably benign Het
Kif24 A T 4: 41,423,498 V251E probably damaging Het
Nupr1 T C 7: 126,625,346 Y30C probably damaging Het
Olfr1137 A T 2: 87,711,471 L145* probably null Het
Olfr1475 T A 19: 13,479,755 M148L probably benign Het
Olfr943 T A 9: 39,184,298 I40N probably damaging Het
Olfr998 A G 2: 85,590,998 I153V probably benign Het
P2ry1 T A 3: 61,003,794 I118N possibly damaging Het
Pcdh1 C T 18: 38,199,210 V247M probably benign Het
Pdia5 A G 16: 35,429,923 V222A possibly damaging Het
Plce1 G A 19: 38,725,051 probably null Het
Ppm1m T C 9: 106,197,228 R239G probably damaging Het
Prkcz A T 4: 155,268,195 F492I probably damaging Het
Rpl6 T C 5: 121,208,849 I269T possibly damaging Het
Scoc T C 8: 83,458,336 S2G unknown Het
Spesp1 A T 9: 62,272,639 M329K probably benign Het
Ston2 T C 12: 91,648,330 K435E probably damaging Het
Synj2 A T 17: 5,975,874 L69F probably damaging Het
Tigd5 T C 15: 75,909,993 I68T probably damaging Het
Tmcc2 A T 1: 132,358,982 M577K probably damaging Het
Tmem131l A T 3: 83,942,491 I263N possibly damaging Het
Trip13 T C 13: 73,913,320 E408G probably benign Het
Txnl4b T C 8: 109,569,103 probably null Het
Ube2o T C 11: 116,539,543 E1123G probably damaging Het
Vmn1r123 A G 7: 21,162,849 H222R possibly damaging Het
Vmn2r73 G T 7: 85,872,932 H66Q probably benign Het
Zc3h13 T A 14: 75,330,423 V1052D probably benign Het
Other mutations in Gucy1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Gucy1a1 APN 3 82111191 missense probably benign 0.00
IGL01626:Gucy1a1 APN 3 82108619 missense probably damaging 1.00
IGL01662:Gucy1a1 APN 3 82109253 missense possibly damaging 0.63
IGL02480:Gucy1a1 APN 3 82097733 missense probably damaging 1.00
IGL02902:Gucy1a1 APN 3 82118917 missense possibly damaging 0.87
IGL03022:Gucy1a1 APN 3 82109097 missense probably benign 0.30
IGL03056:Gucy1a1 APN 3 82113287 missense probably benign 0.00
IGL03089:Gucy1a1 APN 3 82097681 missense probably damaging 1.00
IGL03226:Gucy1a1 APN 3 82119024 missense probably benign 0.00
IGL03377:Gucy1a1 APN 3 82106015 missense probably damaging 1.00
R0245:Gucy1a1 UTSW 3 82108787 missense possibly damaging 0.67
R0762:Gucy1a1 UTSW 3 82094896 missense unknown
R0907:Gucy1a1 UTSW 3 82111191 missense probably benign 0.00
R1242:Gucy1a1 UTSW 3 82105953 unclassified probably null
R1625:Gucy1a1 UTSW 3 82102055 missense probably benign 0.02
R1671:Gucy1a1 UTSW 3 82106222 missense probably damaging 1.00
R2056:Gucy1a1 UTSW 3 82109285 missense possibly damaging 0.89
R2094:Gucy1a1 UTSW 3 82113332 missense probably benign
R2140:Gucy1a1 UTSW 3 82118886 splice site probably null
R2154:Gucy1a1 UTSW 3 82111151 critical splice donor site probably null
R3418:Gucy1a1 UTSW 3 82106133 missense probably damaging 1.00
R3419:Gucy1a1 UTSW 3 82106133 missense probably damaging 1.00
R4290:Gucy1a1 UTSW 3 82094759 missense possibly damaging 0.95
R4291:Gucy1a1 UTSW 3 82094759 missense possibly damaging 0.95
R4292:Gucy1a1 UTSW 3 82094759 missense possibly damaging 0.95
R4294:Gucy1a1 UTSW 3 82094759 missense possibly damaging 0.95
R4573:Gucy1a1 UTSW 3 82108922 missense possibly damaging 0.95
R4629:Gucy1a1 UTSW 3 82097624 missense probably damaging 1.00
R4755:Gucy1a1 UTSW 3 82094795 missense probably benign 0.40
R4865:Gucy1a1 UTSW 3 82119162 utr 5 prime probably benign
R5528:Gucy1a1 UTSW 3 82109073 missense probably damaging 1.00
R5933:Gucy1a1 UTSW 3 82094807 missense probably damaging 0.96
R6385:Gucy1a1 UTSW 3 82109006 missense probably benign
R7011:Gucy1a1 UTSW 3 82109115 missense probably damaging 1.00
R7361:Gucy1a1 UTSW 3 82097720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGTCTCCCAAGGACAGTG -3'
(R):5'- ACACTCAAGGAAAACTGTCAGG -3'

Sequencing Primer
(F):5'- TGTCTCCCAAGGACAGTGAAAGC -3'
(R):5'- CAGGTGAGAGGTGACTTTGCAG -3'
Posted On2018-03-15