Incidental Mutation 'R6278:Tmem131l'
ID507765
Institutional Source Beutler Lab
Gene Symbol Tmem131l
Ensembl Gene ENSMUSG00000033767
Gene Nametransmembrane 131 like
SynonymsD930015E06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R6278 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location83897655-84040175 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83942491 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 263 (I263N)
Ref Sequence ENSEMBL: ENSMUSP00000049808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052342] [ENSMUST00000191758] [ENSMUST00000192095]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052342
AA Change: I263N

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049808
Gene: ENSMUSG00000033767
AA Change: I263N

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:TMEM131_like 91 174 5.8e-20 PFAM
low complexity region 464 477 N/A INTRINSIC
low complexity region 612 630 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
low complexity region 990 997 N/A INTRINSIC
low complexity region 1221 1239 N/A INTRINSIC
low complexity region 1291 1324 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000191758
AA Change: I263N

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141438
Gene: ENSMUSG00000033767
AA Change: I263N

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:DUF3651 155 228 9.2e-10 PFAM
Pfam:DUF3651 285 362 1.5e-9 PFAM
low complexity region 464 477 N/A INTRINSIC
low complexity region 612 630 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
low complexity region 990 997 N/A INTRINSIC
low complexity region 1221 1239 N/A INTRINSIC
low complexity region 1291 1324 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000192095
AA Change: I263N

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141607
Gene: ENSMUSG00000033767
AA Change: I263N

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:DUF3651 155 228 8.8e-10 PFAM
Pfam:DUF3651 285 362 1.4e-9 PFAM
low complexity region 464 477 N/A INTRINSIC
low complexity region 612 630 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
low complexity region 989 996 N/A INTRINSIC
low complexity region 1220 1238 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194522
Meta Mutation Damage Score 0.056 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 T C 7: 119,773,849 S192P probably damaging Het
Amy1 T A 3: 113,561,690 Y348F probably damaging Het
Brpf3 C A 17: 28,821,284 P893H probably benign Het
Cage1 T C 13: 38,016,419 T702A possibly damaging Het
Cdk11b A G 4: 155,649,603 probably benign Het
Cdk5rap3 T C 11: 96,911,903 Y207C probably damaging Het
Cenpc1 T C 5: 86,035,535 K465R probably damaging Het
Cldn14 A C 16: 93,919,598 L120R possibly damaging Het
Cyp2c69 A T 19: 39,843,063 C435* probably null Het
Dmxl2 T A 9: 54,415,762 E1446V probably damaging Het
Dnah17 T A 11: 118,126,290 D208V probably damaging Het
Eif4g3 G T 4: 138,188,083 G1430V possibly damaging Het
Eif5 T A 12: 111,542,793 D284E probably benign Het
Fam47e T C 5: 92,562,517 L125P probably damaging Het
Far1 A G 7: 113,568,137 I476M probably benign Het
Fsip2 A T 2: 82,988,898 I4992L probably benign Het
Gli3 T A 13: 15,725,113 N1028K possibly damaging Het
Gm13128 C T 4: 144,330,267 P7S probably damaging Het
Gucy1a1 T C 3: 82,097,634 K615E probably damaging Het
Gykl1 G T 18: 52,695,208 S496I probably benign Het
Hmcn1 C T 1: 150,697,419 probably null Het
Itga2 T A 13: 114,845,888 H1027L probably benign Het
Kif24 A T 4: 41,423,498 V251E probably damaging Het
Nupr1 T C 7: 126,625,346 Y30C probably damaging Het
Olfr1137 A T 2: 87,711,471 L145* probably null Het
Olfr1475 T A 19: 13,479,755 M148L probably benign Het
Olfr943 T A 9: 39,184,298 I40N probably damaging Het
Olfr998 A G 2: 85,590,998 I153V probably benign Het
P2ry1 T A 3: 61,003,794 I118N possibly damaging Het
Pcdh1 C T 18: 38,199,210 V247M probably benign Het
Pdia5 A G 16: 35,429,923 V222A possibly damaging Het
Plce1 G A 19: 38,725,051 probably null Het
Ppm1m T C 9: 106,197,228 R239G probably damaging Het
Prkcz A T 4: 155,268,195 F492I probably damaging Het
Rpl6 T C 5: 121,208,849 I269T possibly damaging Het
Scoc T C 8: 83,458,336 S2G unknown Het
Spesp1 A T 9: 62,272,639 M329K probably benign Het
Ston2 T C 12: 91,648,330 K435E probably damaging Het
Synj2 A T 17: 5,975,874 L69F probably damaging Het
Tigd5 T C 15: 75,909,993 I68T probably damaging Het
Tmcc2 A T 1: 132,358,982 M577K probably damaging Het
Trip13 T C 13: 73,913,320 E408G probably benign Het
Txnl4b T C 8: 109,569,103 probably null Het
Ube2o T C 11: 116,539,543 E1123G probably damaging Het
Vmn1r123 A G 7: 21,162,849 H222R possibly damaging Het
Vmn2r73 G T 7: 85,872,932 H66Q probably benign Het
Zc3h13 T A 14: 75,330,423 V1052D probably benign Het
Other mutations in Tmem131l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Tmem131l APN 3 83942500 missense probably damaging 0.99
IGL00777:Tmem131l APN 3 83899290 missense probably damaging 1.00
IGL01400:Tmem131l APN 3 83922122 missense probably damaging 0.99
IGL01642:Tmem131l APN 3 83938050 missense possibly damaging 0.63
IGL01796:Tmem131l APN 3 83938055 nonsense probably null
IGL02055:Tmem131l APN 3 83910366 splice site probably null
IGL02269:Tmem131l APN 3 83938050 missense possibly damaging 0.63
IGL02806:Tmem131l APN 3 83928816 splice site probably benign
IGL03308:Tmem131l APN 3 83940902 missense probably benign 0.00
IGL03345:Tmem131l APN 3 83961589 missense probably damaging 1.00
R0106:Tmem131l UTSW 3 83934815 splice site probably benign
R0112:Tmem131l UTSW 3 83940587 nonsense probably null
R0212:Tmem131l UTSW 3 83913268 missense probably benign 0.19
R0328:Tmem131l UTSW 3 83921931 splice site probably benign
R0412:Tmem131l UTSW 3 84031648 missense probably damaging 1.00
R0544:Tmem131l UTSW 3 83898546 missense probably damaging 1.00
R0676:Tmem131l UTSW 3 83934815 splice site probably benign
R0815:Tmem131l UTSW 3 83940572 missense probably benign 0.01
R0826:Tmem131l UTSW 3 83898417 missense probably damaging 1.00
R1432:Tmem131l UTSW 3 83928714 missense probably damaging 1.00
R1582:Tmem131l UTSW 3 83931783 missense probably damaging 0.99
R1591:Tmem131l UTSW 3 83940889 critical splice donor site probably null
R1804:Tmem131l UTSW 3 83910479 missense possibly damaging 0.72
R1875:Tmem131l UTSW 3 83905076 nonsense probably null
R1955:Tmem131l UTSW 3 83961544 missense probably damaging 1.00
R2049:Tmem131l UTSW 3 83942788 missense probably damaging 1.00
R2125:Tmem131l UTSW 3 83942751 critical splice donor site probably null
R2173:Tmem131l UTSW 3 83926145 missense probably damaging 1.00
R2321:Tmem131l UTSW 3 83936023 missense probably damaging 0.98
R2407:Tmem131l UTSW 3 83922048 missense probably benign 0.25
R2917:Tmem131l UTSW 3 83937580 nonsense probably null
R3082:Tmem131l UTSW 3 83909150 critical splice donor site probably null
R3086:Tmem131l UTSW 3 83931739 missense probably benign 0.00
R3773:Tmem131l UTSW 3 83898586 missense probably damaging 1.00
R3921:Tmem131l UTSW 3 83940601 missense possibly damaging 0.68
R3953:Tmem131l UTSW 3 83910419 missense probably damaging 1.00
R3954:Tmem131l UTSW 3 83910419 missense probably damaging 1.00
R3956:Tmem131l UTSW 3 83910419 missense probably damaging 1.00
R4118:Tmem131l UTSW 3 83960767 missense probably benign 0.00
R4700:Tmem131l UTSW 3 83899212 missense probably benign
R4862:Tmem131l UTSW 3 83898210 splice site probably benign
R4941:Tmem131l UTSW 3 83899239 missense probably benign 0.03
R5101:Tmem131l UTSW 3 83937504 missense probably damaging 0.96
R5290:Tmem131l UTSW 3 83899265 missense probably benign 0.30
R5501:Tmem131l UTSW 3 83926128 missense probably damaging 1.00
R5813:Tmem131l UTSW 3 83940572 missense probably benign 0.01
R5845:Tmem131l UTSW 3 83940553 missense probably damaging 0.99
R5973:Tmem131l UTSW 3 83922246 missense possibly damaging 0.95
R6119:Tmem131l UTSW 3 83898382 missense probably damaging 1.00
R6241:Tmem131l UTSW 3 83922164 missense probably benign 0.06
R6490:Tmem131l UTSW 3 83913280 missense possibly damaging 0.67
R6502:Tmem131l UTSW 3 83922408 missense probably damaging 1.00
R6503:Tmem131l UTSW 3 83940944 missense probably benign 0.26
R6868:Tmem131l UTSW 3 83961631 missense probably damaging 0.99
R7104:Tmem131l UTSW 3 83919459 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TGGCCATGCTGCAAGAAAG -3'
(R):5'- GTGTATTCTCATCCTCAATAGGCTC -3'

Sequencing Primer
(F):5'- CCATGCTGCAAGAAAGTTTGTAG -3'
(R):5'- GCTCTTGCCTCGACTGTTTTC -3'
Posted On2018-03-15