Incidental Mutation 'R6278:Kif24'
ID507767
Institutional Source Beutler Lab
Gene Symbol Kif24
Ensembl Gene ENSMUSG00000028438
Gene Namekinesin family member 24
Synonyms4933425J19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6278 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location41390745-41464887 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41423498 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 251 (V251E)
Ref Sequence ENSEMBL: ENSMUSP00000103690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030148] [ENSMUST00000108055]
Predicted Effect probably damaging
Transcript: ENSMUST00000030148
AA Change: V251E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030148
Gene: ENSMUSG00000028438
AA Change: V251E

DomainStartEndE-ValueType
KISc 216 413 2.51e-29 SMART
low complexity region 481 499 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
low complexity region 626 644 N/A INTRINSIC
low complexity region 678 695 N/A INTRINSIC
low complexity region 1119 1130 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108055
AA Change: V251E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103690
Gene: ENSMUSG00000028438
AA Change: V251E

DomainStartEndE-ValueType
Blast:KISc 82 205 1e-47 BLAST
KISc 216 547 3.09e-134 SMART
low complexity region 615 633 N/A INTRINSIC
low complexity region 697 708 N/A INTRINSIC
low complexity region 760 778 N/A INTRINSIC
low complexity region 812 829 N/A INTRINSIC
low complexity region 1253 1264 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154175
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Kinesins, such as KIF24, are microtubule-dependent ATPases that function as molecular motors. They play important roles in intracellular vesicle transport and cell division (summary by Venturelli et al., 2010 [PubMed 20670673]).[supplied by OMIM, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 T C 7: 119,773,849 S192P probably damaging Het
Amy1 T A 3: 113,561,690 Y348F probably damaging Het
Brpf3 C A 17: 28,821,284 P893H probably benign Het
Cage1 T C 13: 38,016,419 T702A possibly damaging Het
Cdk11b A G 4: 155,649,603 probably benign Het
Cdk5rap3 T C 11: 96,911,903 Y207C probably damaging Het
Cenpc1 T C 5: 86,035,535 K465R probably damaging Het
Cldn14 A C 16: 93,919,598 L120R possibly damaging Het
Cyp2c69 A T 19: 39,843,063 C435* probably null Het
Dmxl2 T A 9: 54,415,762 E1446V probably damaging Het
Dnah17 T A 11: 118,126,290 D208V probably damaging Het
Eif4g3 G T 4: 138,188,083 G1430V possibly damaging Het
Eif5 T A 12: 111,542,793 D284E probably benign Het
Fam47e T C 5: 92,562,517 L125P probably damaging Het
Far1 A G 7: 113,568,137 I476M probably benign Het
Fsip2 A T 2: 82,988,898 I4992L probably benign Het
Gli3 T A 13: 15,725,113 N1028K possibly damaging Het
Gm13128 C T 4: 144,330,267 P7S probably damaging Het
Gucy1a1 T C 3: 82,097,634 K615E probably damaging Het
Gykl1 G T 18: 52,695,208 S496I probably benign Het
Hmcn1 C T 1: 150,697,419 probably null Het
Itga2 T A 13: 114,845,888 H1027L probably benign Het
Nupr1 T C 7: 126,625,346 Y30C probably damaging Het
Olfr1137 A T 2: 87,711,471 L145* probably null Het
Olfr1475 T A 19: 13,479,755 M148L probably benign Het
Olfr943 T A 9: 39,184,298 I40N probably damaging Het
Olfr998 A G 2: 85,590,998 I153V probably benign Het
P2ry1 T A 3: 61,003,794 I118N possibly damaging Het
Pcdh1 C T 18: 38,199,210 V247M probably benign Het
Pdia5 A G 16: 35,429,923 V222A possibly damaging Het
Plce1 G A 19: 38,725,051 probably null Het
Ppm1m T C 9: 106,197,228 R239G probably damaging Het
Prkcz A T 4: 155,268,195 F492I probably damaging Het
Rpl6 T C 5: 121,208,849 I269T possibly damaging Het
Scoc T C 8: 83,458,336 S2G unknown Het
Spesp1 A T 9: 62,272,639 M329K probably benign Het
Ston2 T C 12: 91,648,330 K435E probably damaging Het
Synj2 A T 17: 5,975,874 L69F probably damaging Het
Tigd5 T C 15: 75,909,993 I68T probably damaging Het
Tmcc2 A T 1: 132,358,982 M577K probably damaging Het
Tmem131l A T 3: 83,942,491 I263N possibly damaging Het
Trip13 T C 13: 73,913,320 E408G probably benign Het
Txnl4b T C 8: 109,569,103 probably null Het
Ube2o T C 11: 116,539,543 E1123G probably damaging Het
Vmn1r123 A G 7: 21,162,849 H222R possibly damaging Het
Vmn2r73 G T 7: 85,872,932 H66Q probably benign Het
Zc3h13 T A 14: 75,330,423 V1052D probably benign Het
Other mutations in Kif24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Kif24 APN 4 41413826 splice site probably null
IGL00787:Kif24 APN 4 41397583 missense probably damaging 1.00
IGL01065:Kif24 APN 4 41423639 unclassified probably benign
IGL01716:Kif24 APN 4 41393454 missense probably benign 0.40
IGL01796:Kif24 APN 4 41392978 unclassified probably benign
IGL02307:Kif24 APN 4 41395274 missense probably benign 0.02
IGL03061:Kif24 APN 4 41394323 missense possibly damaging 0.86
IGL03080:Kif24 APN 4 41394417 missense probably benign 0.12
IGL03100:Kif24 APN 4 41394446 missense possibly damaging 0.59
R0226:Kif24 UTSW 4 41414939 nonsense probably null
R0345:Kif24 UTSW 4 41428413 missense probably benign 0.01
R0365:Kif24 UTSW 4 41428731 missense probably benign 0.06
R0366:Kif24 UTSW 4 41428717 missense possibly damaging 0.77
R0579:Kif24 UTSW 4 41393706 missense probably damaging 0.97
R0682:Kif24 UTSW 4 41428620 missense probably benign 0.01
R1611:Kif24 UTSW 4 41423552 missense probably benign 0.02
R1634:Kif24 UTSW 4 41393529 missense probably benign 0.02
R1772:Kif24 UTSW 4 41409787 missense probably damaging 1.00
R1997:Kif24 UTSW 4 41392904 missense possibly damaging 0.92
R3833:Kif24 UTSW 4 41395064 missense probably damaging 1.00
R3849:Kif24 UTSW 4 41404734 missense probably damaging 1.00
R4356:Kif24 UTSW 4 41413827 critical splice donor site probably null
R4357:Kif24 UTSW 4 41413827 critical splice donor site probably null
R4358:Kif24 UTSW 4 41413827 critical splice donor site probably null
R4359:Kif24 UTSW 4 41413827 critical splice donor site probably null
R4406:Kif24 UTSW 4 41393954 missense probably damaging 1.00
R4580:Kif24 UTSW 4 41395287 missense probably damaging 1.00
R4756:Kif24 UTSW 4 41397545 critical splice donor site probably null
R4921:Kif24 UTSW 4 41394329 missense probably damaging 0.99
R4935:Kif24 UTSW 4 41394939 missense probably damaging 0.99
R5288:Kif24 UTSW 4 41395373 missense probably benign 0.09
R5398:Kif24 UTSW 4 41394401 missense possibly damaging 0.50
R5885:Kif24 UTSW 4 41423463 missense probably damaging 1.00
R5901:Kif24 UTSW 4 41428604 missense probably damaging 1.00
R5919:Kif24 UTSW 4 41394477 missense possibly damaging 0.62
R5945:Kif24 UTSW 4 41428670 nonsense probably null
R6291:Kif24 UTSW 4 41413959 missense probably damaging 1.00
R6891:Kif24 UTSW 4 41394168 missense probably benign 0.33
R7178:Kif24 UTSW 4 41395085 missense probably benign 0.00
R7437:Kif24 UTSW 4 41404687 missense possibly damaging 0.70
R7453:Kif24 UTSW 4 41394673 missense possibly damaging 0.91
Z1088:Kif24 UTSW 4 41395091 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGTAGAGCCTCATTGCATAAAGC -3'
(R):5'- TGTACTGACACTTTGACCATTTAAG -3'

Sequencing Primer
(F):5'- TCTAGCAAGGGTGAGATCCTATC -3'
(R):5'- CCTCAGAGAATCCTTGGA -3'
Posted On2018-03-15