Incidental Mutation 'R6278:Eif4g3'
ID507768
Institutional Source Beutler Lab
Gene Symbol Eif4g3
Ensembl Gene ENSMUSG00000028760
Gene Nameeukaryotic translation initiation factor 4 gamma, 3
Synonyms1500002J22Rik, repro8, G1-419-52, 4930523M17Rik, eIF4GII
MMRRC Submission
Accession Numbers

Genbank: NM_172703; MGI: 1923935

Is this an essential gene? Possibly non essential (E-score: 0.285) question?
Stock #R6278 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location137993022-138208508 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 138188083 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 1430 (G1430V)
Ref Sequence ENSEMBL: ENSMUSP00000145147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084214] [ENSMUST00000084215] [ENSMUST00000105831] [ENSMUST00000140796] [ENSMUST00000203828]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084214
AA Change: G1246V

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000081232
Gene: ENSMUSG00000028760
AA Change: G1246V

DomainStartEndE-ValueType
low complexity region 24 43 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
low complexity region 147 152 N/A INTRINSIC
PDB:1LJ2|D 154 179 8e-9 PDB
low complexity region 192 207 N/A INTRINSIC
low complexity region 269 310 N/A INTRINSIC
low complexity region 427 444 N/A INTRINSIC
low complexity region 534 550 N/A INTRINSIC
low complexity region 579 588 N/A INTRINSIC
low complexity region 592 616 N/A INTRINSIC
Blast:MIF4G 617 708 5e-49 BLAST
Blast:MIF4G 722 765 5e-16 BLAST
MIF4G 768 996 1.42e-65 SMART
low complexity region 1086 1109 N/A INTRINSIC
MA3 1215 1327 9.29e-38 SMART
eIF5C 1487 1574 7.92e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084215
AA Change: G1247V

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000081233
Gene: ENSMUSG00000028760
AA Change: G1247V

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
low complexity region 75 102 N/A INTRINSIC
low complexity region 129 134 N/A INTRINSIC
PDB:1LJ2|D 136 161 8e-9 PDB
low complexity region 174 189 N/A INTRINSIC
low complexity region 251 292 N/A INTRINSIC
low complexity region 409 426 N/A INTRINSIC
low complexity region 516 532 N/A INTRINSIC
low complexity region 561 570 N/A INTRINSIC
low complexity region 574 598 N/A INTRINSIC
Blast:MIF4G 599 690 4e-49 BLAST
Blast:MIF4G 704 747 5e-16 BLAST
MIF4G 750 978 1.42e-65 SMART
low complexity region 1068 1113 N/A INTRINSIC
MA3 1216 1328 9.29e-38 SMART
eIF5C 1488 1575 7.92e-36 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105831
AA Change: G1235V

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101457
Gene: ENSMUSG00000028760
AA Change: G1235V

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
low complexity region 82 109 N/A INTRINSIC
low complexity region 136 141 N/A INTRINSIC
PDB:1LJ2|D 143 168 8e-9 PDB
low complexity region 181 196 N/A INTRINSIC
low complexity region 258 299 N/A INTRINSIC
low complexity region 416 433 N/A INTRINSIC
low complexity region 523 539 N/A INTRINSIC
low complexity region 568 577 N/A INTRINSIC
low complexity region 581 605 N/A INTRINSIC
Blast:MIF4G 606 697 4e-49 BLAST
Blast:MIF4G 711 754 5e-16 BLAST
MIF4G 757 985 1.42e-65 SMART
low complexity region 1075 1098 N/A INTRINSIC
MA3 1204 1316 9.29e-38 SMART
eIF5C 1476 1563 7.92e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133902
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140317
Predicted Effect probably benign
Transcript: ENSMUST00000140796
AA Change: G670V

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000115946
Gene: ENSMUSG00000028760
AA Change: G670V

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
low complexity region 16 40 N/A INTRINSIC
Blast:MIF4G 41 132 2e-49 BLAST
Blast:MIF4G 146 189 3e-16 BLAST
MIF4G 192 420 1.42e-65 SMART
low complexity region 510 533 N/A INTRINSIC
MA3 639 751 9.29e-38 SMART
eIF5C 911 998 7.92e-36 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000203828
AA Change: G1430V

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000145147
Gene: ENSMUSG00000028760
AA Change: G1430V

DomainStartEndE-ValueType
low complexity region 41 81 N/A INTRINSIC
low complexity region 193 208 N/A INTRINSIC
low complexity region 258 285 N/A INTRINSIC
low complexity region 312 317 N/A INTRINSIC
PDB:1LJ2|D 319 344 9e-9 PDB
low complexity region 357 372 N/A INTRINSIC
low complexity region 434 475 N/A INTRINSIC
low complexity region 592 609 N/A INTRINSIC
low complexity region 699 715 N/A INTRINSIC
low complexity region 744 753 N/A INTRINSIC
low complexity region 757 781 N/A INTRINSIC
Blast:MIF4G 782 873 9e-49 BLAST
Blast:MIF4G 887 930 5e-16 BLAST
MIF4G 933 1161 6e-68 SMART
coiled coil region 1174 1201 N/A INTRINSIC
low complexity region 1251 1296 N/A INTRINSIC
MA3 1399 1511 3.9e-40 SMART
eIF5C 1671 1758 3.9e-38 SMART
Meta Mutation Damage Score 0.158 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be part of the eIF4F protein complex, which is involved in mRNA cap recognition and transport of mRNAs to the ribosome. Interestingly, a microRNA (miR-520c-3p) has been found that negatively regulates synthesis of the encoded protein, and this leads to a global decrease in protein translation and cell proliferation. Therefore, this protein is a key component of the anti-tumor activity of miR-520c-3p. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for an ENU induced allele exhibit decreased testes weight, azoospermia, and arrested male meiosis. Mice homozygous for a gene trapped allele exhibit small testes. [provided by MGI curators]
Allele List at MGI

All alleles(27) : Gene trapped(27)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 T C 7: 119,773,849 S192P probably damaging Het
Amy1 T A 3: 113,561,690 Y348F probably damaging Het
Brpf3 C A 17: 28,821,284 P893H probably benign Het
Cage1 T C 13: 38,016,419 T702A possibly damaging Het
Cdk11b A G 4: 155,649,603 probably benign Het
Cdk5rap3 T C 11: 96,911,903 Y207C probably damaging Het
Cenpc1 T C 5: 86,035,535 K465R probably damaging Het
Cldn14 A C 16: 93,919,598 L120R possibly damaging Het
Cyp2c69 A T 19: 39,843,063 C435* probably null Het
Dmxl2 T A 9: 54,415,762 E1446V probably damaging Het
Dnah17 T A 11: 118,126,290 D208V probably damaging Het
Eif5 T A 12: 111,542,793 D284E probably benign Het
Fam47e T C 5: 92,562,517 L125P probably damaging Het
Far1 A G 7: 113,568,137 I476M probably benign Het
Fsip2 A T 2: 82,988,898 I4992L probably benign Het
Gli3 T A 13: 15,725,113 N1028K possibly damaging Het
Gm13128 C T 4: 144,330,267 P7S probably damaging Het
Gucy1a1 T C 3: 82,097,634 K615E probably damaging Het
Gykl1 G T 18: 52,695,208 S496I probably benign Het
Hmcn1 C T 1: 150,697,419 probably null Het
Itga2 T A 13: 114,845,888 H1027L probably benign Het
Kif24 A T 4: 41,423,498 V251E probably damaging Het
Nupr1 T C 7: 126,625,346 Y30C probably damaging Het
Olfr1137 A T 2: 87,711,471 L145* probably null Het
Olfr1475 T A 19: 13,479,755 M148L probably benign Het
Olfr943 T A 9: 39,184,298 I40N probably damaging Het
Olfr998 A G 2: 85,590,998 I153V probably benign Het
P2ry1 T A 3: 61,003,794 I118N possibly damaging Het
Pcdh1 C T 18: 38,199,210 V247M probably benign Het
Pdia5 A G 16: 35,429,923 V222A possibly damaging Het
Plce1 G A 19: 38,725,051 probably null Het
Ppm1m T C 9: 106,197,228 R239G probably damaging Het
Prkcz A T 4: 155,268,195 F492I probably damaging Het
Rpl6 T C 5: 121,208,849 I269T possibly damaging Het
Scoc T C 8: 83,458,336 S2G unknown Het
Spesp1 A T 9: 62,272,639 M329K probably benign Het
Ston2 T C 12: 91,648,330 K435E probably damaging Het
Synj2 A T 17: 5,975,874 L69F probably damaging Het
Tigd5 T C 15: 75,909,993 I68T probably damaging Het
Tmcc2 A T 1: 132,358,982 M577K probably damaging Het
Tmem131l A T 3: 83,942,491 I263N possibly damaging Het
Trip13 T C 13: 73,913,320 E408G probably benign Het
Txnl4b T C 8: 109,569,103 probably null Het
Ube2o T C 11: 116,539,543 E1123G probably damaging Het
Vmn1r123 A G 7: 21,162,849 H222R possibly damaging Het
Vmn2r73 G T 7: 85,872,932 H66Q probably benign Het
Zc3h13 T A 14: 75,330,423 V1052D probably benign Het
Other mutations in Eif4g3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01817:Eif4g3 APN 4 138120362 missense probably benign 0.01
IGL02171:Eif4g3 APN 4 138126589 missense probably benign 0.03
IGL02487:Eif4g3 APN 4 138203378 missense possibly damaging 0.92
IGL02514:Eif4g3 APN 4 138126194 missense possibly damaging 0.87
IGL02622:Eif4g3 APN 4 138097366 splice site probably benign
IGL02725:Eif4g3 APN 4 138170471 splice site probably benign
IGL02735:Eif4g3 APN 4 138126211 missense probably benign 0.40
IGL03008:Eif4g3 APN 4 138120388 missense probably damaging 1.00
IGL03077:Eif4g3 APN 4 138125855 missense probably damaging 1.00
N/A - 535:Eif4g3 UTSW 4 138120428 missense probably damaging 0.98
R0013:Eif4g3 UTSW 4 138175848 missense possibly damaging 0.88
R0193:Eif4g3 UTSW 4 138146376 splice site probably benign
R0240:Eif4g3 UTSW 4 138170562 missense probably damaging 0.98
R0240:Eif4g3 UTSW 4 138170562 missense probably damaging 0.98
R0563:Eif4g3 UTSW 4 138175840 splice site probably benign
R0841:Eif4g3 UTSW 4 138165818 missense probably damaging 1.00
R0884:Eif4g3 UTSW 4 138151776 missense possibly damaging 0.76
R1116:Eif4g3 UTSW 4 138091775 critical splice donor site probably null
R1145:Eif4g3 UTSW 4 138165818 missense probably damaging 1.00
R1145:Eif4g3 UTSW 4 138165818 missense probably damaging 1.00
R1192:Eif4g3 UTSW 4 138171186 missense probably damaging 1.00
R1401:Eif4g3 UTSW 4 138206084 missense probably damaging 0.99
R1535:Eif4g3 UTSW 4 138097302 missense probably damaging 1.00
R1571:Eif4g3 UTSW 4 138120408 missense probably damaging 1.00
R1576:Eif4g3 UTSW 4 138096870 missense probably damaging 0.99
R1607:Eif4g3 UTSW 4 138126563 missense probably benign 0.00
R1618:Eif4g3 UTSW 4 138206058 missense probably damaging 1.00
R1793:Eif4g3 UTSW 4 138171131 missense probably damaging 1.00
R1823:Eif4g3 UTSW 4 138180491 missense probably benign 0.37
R1857:Eif4g3 UTSW 4 138175876 missense possibly damaging 0.67
R1907:Eif4g3 UTSW 4 138158415 missense probably damaging 1.00
R2041:Eif4g3 UTSW 4 138105306 splice site probably benign
R2106:Eif4g3 UTSW 4 138082919 start gained probably benign
R2124:Eif4g3 UTSW 4 138184742 missense probably damaging 1.00
R2301:Eif4g3 UTSW 4 138172659 missense probably damaging 1.00
R2519:Eif4g3 UTSW 4 138097318 missense probably benign 0.37
R3033:Eif4g3 UTSW 4 138103410 missense probably damaging 1.00
R3870:Eif4g3 UTSW 4 138096900 missense probably damaging 0.98
R4542:Eif4g3 UTSW 4 138203417 missense probably damaging 0.99
R4582:Eif4g3 UTSW 4 138171245 missense probably damaging 1.00
R4607:Eif4g3 UTSW 4 138126458 missense probably benign 0.03
R4608:Eif4g3 UTSW 4 138126458 missense probably benign 0.03
R4658:Eif4g3 UTSW 4 138206132 missense probably damaging 1.00
R4736:Eif4g3 UTSW 4 138198097 missense probably benign 0.01
R4739:Eif4g3 UTSW 4 138183199 missense possibly damaging 0.79
R4739:Eif4g3 UTSW 4 138198097 missense probably benign 0.01
R4740:Eif4g3 UTSW 4 138198097 missense probably benign 0.01
R4760:Eif4g3 UTSW 4 138084318 missense possibly damaging 0.46
R4825:Eif4g3 UTSW 4 138194081 missense probably benign
R4826:Eif4g3 UTSW 4 138177945 missense possibly damaging 0.95
R4941:Eif4g3 UTSW 4 138170565 missense probably damaging 1.00
R5040:Eif4g3 UTSW 4 138096889 missense probably damaging 0.99
R5070:Eif4g3 UTSW 4 138146299 missense probably benign 0.00
R5155:Eif4g3 UTSW 4 138126743 missense probably benign 0.36
R5226:Eif4g3 UTSW 4 138096794 missense possibly damaging 0.93
R5229:Eif4g3 UTSW 4 138096794 missense possibly damaging 0.93
R5303:Eif4g3 UTSW 4 138126562 missense probably benign 0.04
R5369:Eif4g3 UTSW 4 138183334 missense possibly damaging 0.87
R5394:Eif4g3 UTSW 4 138103398 unclassified probably null
R5665:Eif4g3 UTSW 4 138126589 missense probably benign 0.03
R5678:Eif4g3 UTSW 4 138151742 missense probably damaging 0.99
R5695:Eif4g3 UTSW 4 138163433 splice site probably null
R5704:Eif4g3 UTSW 4 138190692 missense probably damaging 1.00
R5924:Eif4g3 UTSW 4 138201926 missense probably damaging 1.00
R6214:Eif4g3 UTSW 4 138058003 missense probably damaging 0.99
R6519:Eif4g3 UTSW 4 137994008 missense probably benign
R6659:Eif4g3 UTSW 4 138177932 missense probably damaging 1.00
R6720:Eif4g3 UTSW 4 138175832 intron probably null
R6812:Eif4g3 UTSW 4 138103376 missense probably damaging 1.00
R6922:Eif4g3 UTSW 4 138097335 missense probably damaging 1.00
R7175:Eif4g3 UTSW 4 138126215 missense probably damaging 1.00
R7176:Eif4g3 UTSW 4 138171186 missense probably damaging 1.00
X0067:Eif4g3 UTSW 4 138163619 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAAGCTCTGAGAGGCCATCC -3'
(R):5'- CTAGCAGCTGAGGTGTAAGGATAC -3'

Sequencing Primer
(F):5'- TAGAGCCTTGAACTCAGTGTGCATC -3'
(R):5'- GGATACTGGATACCAACCCTTTG -3'
Posted On2018-03-15