Incidental Mutation 'R6278:Rpl6'
ID507774
Institutional Source Beutler Lab
Gene Symbol Rpl6
Ensembl Gene ENSMUSG00000029614
Gene Nameribosomal protein L6
SynonymsTaxreb107
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R6278 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location121204481-121209241 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121208849 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 269 (I269T)
Ref Sequence ENSEMBL: ENSMUSP00000031617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031617] [ENSMUST00000201155]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031617
AA Change: I269T

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031617
Gene: ENSMUSG00000029614
AA Change: I269T

DomainStartEndE-ValueType
Pfam:Ribosomal_L6e_N 43 103 4.5e-36 PFAM
Pfam:Ribosomal_L6e 189 296 2.7e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082907
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138621
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139177
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197044
Predicted Effect probably benign
Transcript: ENSMUST00000201155
SMART Domains Protein: ENSMUSP00000143981
Gene: ENSMUSG00000029614

DomainStartEndE-ValueType
Blast:Zn_pept 1 33 7e-11 BLAST
PDB:3J39|E 2 45 3e-13 PDB
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 T C 7: 119,773,849 S192P probably damaging Het
Amy1 T A 3: 113,561,690 Y348F probably damaging Het
Brpf3 C A 17: 28,821,284 P893H probably benign Het
Cage1 T C 13: 38,016,419 T702A possibly damaging Het
Cdk11b A G 4: 155,649,603 probably benign Het
Cdk5rap3 T C 11: 96,911,903 Y207C probably damaging Het
Cenpc1 T C 5: 86,035,535 K465R probably damaging Het
Cldn14 A C 16: 93,919,598 L120R possibly damaging Het
Cyp2c69 A T 19: 39,843,063 C435* probably null Het
Dmxl2 T A 9: 54,415,762 E1446V probably damaging Het
Dnah17 T A 11: 118,126,290 D208V probably damaging Het
Eif4g3 G T 4: 138,188,083 G1430V possibly damaging Het
Eif5 T A 12: 111,542,793 D284E probably benign Het
Fam47e T C 5: 92,562,517 L125P probably damaging Het
Far1 A G 7: 113,568,137 I476M probably benign Het
Fsip2 A T 2: 82,988,898 I4992L probably benign Het
Gli3 T A 13: 15,725,113 N1028K possibly damaging Het
Gm13128 C T 4: 144,330,267 P7S probably damaging Het
Gucy1a1 T C 3: 82,097,634 K615E probably damaging Het
Gykl1 G T 18: 52,695,208 S496I probably benign Het
Hmcn1 C T 1: 150,697,419 probably null Het
Itga2 T A 13: 114,845,888 H1027L probably benign Het
Kif24 A T 4: 41,423,498 V251E probably damaging Het
Nupr1 T C 7: 126,625,346 Y30C probably damaging Het
Olfr1137 A T 2: 87,711,471 L145* probably null Het
Olfr1475 T A 19: 13,479,755 M148L probably benign Het
Olfr943 T A 9: 39,184,298 I40N probably damaging Het
Olfr998 A G 2: 85,590,998 I153V probably benign Het
P2ry1 T A 3: 61,003,794 I118N possibly damaging Het
Pcdh1 C T 18: 38,199,210 V247M probably benign Het
Pdia5 A G 16: 35,429,923 V222A possibly damaging Het
Plce1 G A 19: 38,725,051 probably null Het
Ppm1m T C 9: 106,197,228 R239G probably damaging Het
Prkcz A T 4: 155,268,195 F492I probably damaging Het
Scoc T C 8: 83,458,336 S2G unknown Het
Spesp1 A T 9: 62,272,639 M329K probably benign Het
Ston2 T C 12: 91,648,330 K435E probably damaging Het
Synj2 A T 17: 5,975,874 L69F probably damaging Het
Tigd5 T C 15: 75,909,993 I68T probably damaging Het
Tmcc2 A T 1: 132,358,982 M577K probably damaging Het
Tmem131l A T 3: 83,942,491 I263N possibly damaging Het
Trip13 T C 13: 73,913,320 E408G probably benign Het
Txnl4b T C 8: 109,569,103 probably null Het
Ube2o T C 11: 116,539,543 E1123G probably damaging Het
Vmn1r123 A G 7: 21,162,849 H222R possibly damaging Het
Vmn2r73 G T 7: 85,872,932 H66Q probably benign Het
Zc3h13 T A 14: 75,330,423 V1052D probably benign Het
Other mutations in Rpl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02819:Rpl6 APN 5 121207201 splice site probably benign
R0095:Rpl6 UTSW 5 121205839 missense possibly damaging 0.62
R0095:Rpl6 UTSW 5 121205839 missense possibly damaging 0.62
R0197:Rpl6 UTSW 5 121208478 missense probably benign 0.18
R0346:Rpl6 UTSW 5 121208491 missense possibly damaging 0.52
R0883:Rpl6 UTSW 5 121208478 missense probably benign 0.18
R0972:Rpl6 UTSW 5 121208502 missense possibly damaging 0.75
R6005:Rpl6 UTSW 5 121205514 unclassified probably benign
R7021:Rpl6 UTSW 5 121208909 missense probably benign 0.35
R7426:Rpl6 UTSW 5 121205592 missense possibly damaging 0.69
R7488:Rpl6 UTSW 5 121208528 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGCGGTTCTAGTGTGGCAG -3'
(R):5'- GTCTTTCCAGAAAGGGCCAGAG -3'

Sequencing Primer
(F):5'- CAGTCTGAGTTGAGATGGTTGAC -3'
(R):5'- GACACAGAGGAAAAGACACCAGC -3'
Posted On2018-03-15