Incidental Mutation 'R6278:Vmn2r73'
ID507776
Institutional Source Beutler Lab
Gene Symbol Vmn2r73
Ensembl Gene ENSMUSG00000070458
Gene Namevomeronasal 2, receptor 73
SynonymsEG620928
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R6278 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location85857547-85875938 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 85872932 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 66 (H66Q)
Ref Sequence ENSEMBL: ENSMUSP00000076687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077478]
Predicted Effect probably benign
Transcript: ENSMUST00000077478
AA Change: H66Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000076687
Gene: ENSMUSG00000070458
AA Change: H66Q

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 465 1.4e-30 PFAM
Pfam:NCD3G 508 560 5.9e-21 PFAM
Pfam:7tm_3 590 827 4.4e-51 PFAM
Meta Mutation Damage Score 0.1112 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 T C 7: 119,773,849 S192P probably damaging Het
Amy1 T A 3: 113,561,690 Y348F probably damaging Het
Brpf3 C A 17: 28,821,284 P893H probably benign Het
Cage1 T C 13: 38,016,419 T702A possibly damaging Het
Cdk11b A G 4: 155,649,603 probably benign Het
Cdk5rap3 T C 11: 96,911,903 Y207C probably damaging Het
Cenpc1 T C 5: 86,035,535 K465R probably damaging Het
Cldn14 A C 16: 93,919,598 L120R possibly damaging Het
Cyp2c69 A T 19: 39,843,063 C435* probably null Het
Dmxl2 T A 9: 54,415,762 E1446V probably damaging Het
Dnah17 T A 11: 118,126,290 D208V probably damaging Het
Eif4g3 G T 4: 138,188,083 G1430V possibly damaging Het
Eif5 T A 12: 111,542,793 D284E probably benign Het
Fam47e T C 5: 92,562,517 L125P probably damaging Het
Far1 A G 7: 113,568,137 I476M probably benign Het
Fsip2 A T 2: 82,988,898 I4992L probably benign Het
Gli3 T A 13: 15,725,113 N1028K possibly damaging Het
Gm13128 C T 4: 144,330,267 P7S probably damaging Het
Gucy1a1 T C 3: 82,097,634 K615E probably damaging Het
Gykl1 G T 18: 52,695,208 S496I probably benign Het
Hmcn1 C T 1: 150,697,419 probably null Het
Itga2 T A 13: 114,845,888 H1027L probably benign Het
Kif24 A T 4: 41,423,498 V251E probably damaging Het
Nupr1 T C 7: 126,625,346 Y30C probably damaging Het
Olfr1137 A T 2: 87,711,471 L145* probably null Het
Olfr1475 T A 19: 13,479,755 M148L probably benign Het
Olfr943 T A 9: 39,184,298 I40N probably damaging Het
Olfr998 A G 2: 85,590,998 I153V probably benign Het
P2ry1 T A 3: 61,003,794 I118N possibly damaging Het
Pcdh1 C T 18: 38,199,210 V247M probably benign Het
Pdia5 A G 16: 35,429,923 V222A possibly damaging Het
Plce1 G A 19: 38,725,051 probably null Het
Ppm1m T C 9: 106,197,228 R239G probably damaging Het
Prkcz A T 4: 155,268,195 F492I probably damaging Het
Rpl6 T C 5: 121,208,849 I269T possibly damaging Het
Scoc T C 8: 83,458,336 S2G unknown Het
Spesp1 A T 9: 62,272,639 M329K probably benign Het
Ston2 T C 12: 91,648,330 K435E probably damaging Het
Synj2 A T 17: 5,975,874 L69F probably damaging Het
Tigd5 T C 15: 75,909,993 I68T probably damaging Het
Tmcc2 A T 1: 132,358,982 M577K probably damaging Het
Tmem131l A T 3: 83,942,491 I263N possibly damaging Het
Trip13 T C 13: 73,913,320 E408G probably benign Het
Txnl4b T C 8: 109,569,103 probably null Het
Ube2o T C 11: 116,539,543 E1123G probably damaging Het
Vmn1r123 A G 7: 21,162,849 H222R possibly damaging Het
Zc3h13 T A 14: 75,330,423 V1052D probably benign Het
Other mutations in Vmn2r73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Vmn2r73 APN 7 85857587 missense probably benign
IGL01151:Vmn2r73 APN 7 85857878 missense probably damaging 0.99
IGL01408:Vmn2r73 APN 7 85872247 missense probably benign 0.45
IGL01505:Vmn2r73 APN 7 85858059 nonsense probably null
IGL01731:Vmn2r73 APN 7 85857549 makesense probably null
IGL01818:Vmn2r73 APN 7 85869901 splice site probably benign
IGL02236:Vmn2r73 APN 7 85872694 missense probably benign 0.00
IGL02265:Vmn2r73 APN 7 85871639 missense probably benign 0.02
IGL02266:Vmn2r73 APN 7 85875799 missense possibly damaging 0.52
IGL02276:Vmn2r73 APN 7 85869772 critical splice donor site probably null
IGL02284:Vmn2r73 APN 7 85857915 missense possibly damaging 0.92
IGL02380:Vmn2r73 APN 7 85858175 missense probably benign 0.00
IGL02466:Vmn2r73 APN 7 85872876 missense probably damaging 1.00
IGL03172:Vmn2r73 APN 7 85858287 missense probably benign 0.01
IGL03179:Vmn2r73 APN 7 85870260 missense probably benign 0.04
R0077:Vmn2r73 UTSW 7 85875867 missense probably benign 0.00
R0311:Vmn2r73 UTSW 7 85871789 missense probably benign
R0413:Vmn2r73 UTSW 7 85871879 missense possibly damaging 0.68
R0494:Vmn2r73 UTSW 7 85872932 missense probably benign
R1523:Vmn2r73 UTSW 7 85870278 missense probably benign 0.02
R1618:Vmn2r73 UTSW 7 85875912 nonsense probably null
R1667:Vmn2r73 UTSW 7 85857681 missense probably benign 0.00
R1728:Vmn2r73 UTSW 7 85857878 missense probably damaging 1.00
R1729:Vmn2r73 UTSW 7 85857878 missense probably damaging 1.00
R1747:Vmn2r73 UTSW 7 85858167 missense probably damaging 1.00
R1784:Vmn2r73 UTSW 7 85857878 missense probably damaging 1.00
R2152:Vmn2r73 UTSW 7 85857728 missense probably benign 0.03
R2395:Vmn2r73 UTSW 7 85857767 missense probably damaging 1.00
R2415:Vmn2r73 UTSW 7 85872223 missense probably damaging 1.00
R2926:Vmn2r73 UTSW 7 85871663 missense probably benign 0.17
R3719:Vmn2r73 UTSW 7 85870374 missense probably damaging 1.00
R3766:Vmn2r73 UTSW 7 85871990 missense probably benign
R3838:Vmn2r73 UTSW 7 85858050 missense probably benign 0.00
R3890:Vmn2r73 UTSW 7 85857936 missense probably benign
R4030:Vmn2r73 UTSW 7 85871836 missense possibly damaging 0.92
R4247:Vmn2r73 UTSW 7 85872675 missense probably damaging 0.99
R4409:Vmn2r73 UTSW 7 85871560 missense probably damaging 0.97
R4427:Vmn2r73 UTSW 7 85857773 missense probably damaging 1.00
R4430:Vmn2r73 UTSW 7 85870241 missense probably benign
R4552:Vmn2r73 UTSW 7 85875847 missense probably benign 0.12
R4779:Vmn2r73 UTSW 7 85871715 nonsense probably null
R4906:Vmn2r73 UTSW 7 85857621 missense probably damaging 0.99
R4942:Vmn2r73 UTSW 7 85870374 missense probably damaging 1.00
R5280:Vmn2r73 UTSW 7 85857947 missense probably damaging 0.98
R5344:Vmn2r73 UTSW 7 85875838 missense probably benign 0.00
R5478:Vmn2r73 UTSW 7 85869788 missense probably damaging 1.00
R5527:Vmn2r73 UTSW 7 85858367 missense possibly damaging 0.65
R5691:Vmn2r73 UTSW 7 85858091 missense probably damaging 1.00
R5826:Vmn2r73 UTSW 7 85875748 missense possibly damaging 0.77
R6018:Vmn2r73 UTSW 7 85872667 missense possibly damaging 0.48
R6082:Vmn2r73 UTSW 7 85858221 missense probably benign 0.00
R6111:Vmn2r73 UTSW 7 85871789 missense probably benign
R6233:Vmn2r73 UTSW 7 85869891 missense probably benign 0.00
R6283:Vmn2r73 UTSW 7 85871841 missense probably benign 0.00
R6307:Vmn2r73 UTSW 7 85857620 missense probably damaging 1.00
R6413:Vmn2r73 UTSW 7 85870336 nonsense probably null
R6782:Vmn2r73 UTSW 7 85870355 missense probably benign 0.00
R6884:Vmn2r73 UTSW 7 85858005 missense probably benign 0.05
R6921:Vmn2r73 UTSW 7 85858238 missense probably benign 0.27
R7169:Vmn2r73 UTSW 7 85858455 nonsense probably null
R7206:Vmn2r73 UTSW 7 85872867 missense probably benign 0.03
R7311:Vmn2r73 UTSW 7 85871984 missense possibly damaging 0.80
X0023:Vmn2r73 UTSW 7 85858456 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- ACTGCCCATATAGGAGCTGTAAG -3'
(R):5'- GAAGAAGGCTTGTGATAGCATTATG -3'

Sequencing Primer
(F):5'- CTCTCATTTGCACAGTAGTAATTAGG -3'
(R):5'- AAGGCTTGTGATAGCATTATGATTTG -3'
Posted On2018-03-15