Incidental Mutation 'R6278:Far1'
ID507777
Institutional Source Beutler Lab
Gene Symbol Far1
Ensembl Gene ENSMUSG00000030759
Gene Namefatty acyl CoA reductase 1
SynonymsMlstd2, 3732409C05Rik, 2600011M19Rik, 2900034E22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.734) question?
Stock #R6278 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location113513834-113571511 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113568137 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 476 (I476M)
Ref Sequence ENSEMBL: ENSMUSP00000128695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033018] [ENSMUST00000067929] [ENSMUST00000164745]
Predicted Effect probably benign
Transcript: ENSMUST00000033018
AA Change: I476M

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000033018
Gene: ENSMUSG00000030759
AA Change: I476M

DomainStartEndE-ValueType
Pfam:Epimerase 13 177 1e-8 PFAM
Pfam:NAD_binding_4 15 285 3.2e-80 PFAM
Pfam:Sterile 356 448 3.1e-34 PFAM
transmembrane domain 466 483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000067929
AA Change: I476M

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000064334
Gene: ENSMUSG00000030759
AA Change: I476M

DomainStartEndE-ValueType
Pfam:Epimerase 13 177 1e-8 PFAM
Pfam:NAD_binding_4 15 285 3.2e-80 PFAM
Pfam:Sterile 356 448 5.4e-36 PFAM
transmembrane domain 466 483 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155183
Predicted Effect probably benign
Transcript: ENSMUST00000164745
AA Change: I476M

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000128695
Gene: ENSMUSG00000030759
AA Change: I476M

DomainStartEndE-ValueType
Pfam:Epimerase 13 241 1.5e-10 PFAM
Pfam:NAD_binding_4 15 285 9.9e-78 PFAM
Pfam:Sterile 355 448 5.8e-26 PFAM
transmembrane domain 466 483 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is required for the reduction of fatty acids to fatty alcohols, a process that is required for the synthesis of monoesters and ether lipids. NADPH is required as a cofactor in this reaction, and 16-18 carbon saturated and unsaturated fatty acids are the preferred substrate. This is a peroxisomal membrane protein, and studies suggest that the N-terminus contains a large catalytic domain located on the outside of the peroxisome, while the C-terminus is exposed to the matrix of the peroxisome. Studies indicate that the regulation of this protein is dependent on plasmalogen levels. Mutations in this gene have been associated with individuals affected by severe intellectual disability, early-onset epilepsy, microcephaly, congenital cataracts, growth retardation, and spasticity (PMID: 25439727). A pseudogene of this gene is located on chromosome 13. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 T C 7: 119,773,849 S192P probably damaging Het
Amy1 T A 3: 113,561,690 Y348F probably damaging Het
Brpf3 C A 17: 28,821,284 P893H probably benign Het
Cage1 T C 13: 38,016,419 T702A possibly damaging Het
Cdk11b A G 4: 155,649,603 probably benign Het
Cdk5rap3 T C 11: 96,911,903 Y207C probably damaging Het
Cenpc1 T C 5: 86,035,535 K465R probably damaging Het
Cldn14 A C 16: 93,919,598 L120R possibly damaging Het
Cyp2c69 A T 19: 39,843,063 C435* probably null Het
Dmxl2 T A 9: 54,415,762 E1446V probably damaging Het
Dnah17 T A 11: 118,126,290 D208V probably damaging Het
Eif4g3 G T 4: 138,188,083 G1430V possibly damaging Het
Eif5 T A 12: 111,542,793 D284E probably benign Het
Fam47e T C 5: 92,562,517 L125P probably damaging Het
Fsip2 A T 2: 82,988,898 I4992L probably benign Het
Gli3 T A 13: 15,725,113 N1028K possibly damaging Het
Gm13128 C T 4: 144,330,267 P7S probably damaging Het
Gucy1a1 T C 3: 82,097,634 K615E probably damaging Het
Gykl1 G T 18: 52,695,208 S496I probably benign Het
Hmcn1 C T 1: 150,697,419 probably null Het
Itga2 T A 13: 114,845,888 H1027L probably benign Het
Kif24 A T 4: 41,423,498 V251E probably damaging Het
Nupr1 T C 7: 126,625,346 Y30C probably damaging Het
Olfr1137 A T 2: 87,711,471 L145* probably null Het
Olfr1475 T A 19: 13,479,755 M148L probably benign Het
Olfr943 T A 9: 39,184,298 I40N probably damaging Het
Olfr998 A G 2: 85,590,998 I153V probably benign Het
P2ry1 T A 3: 61,003,794 I118N possibly damaging Het
Pcdh1 C T 18: 38,199,210 V247M probably benign Het
Pdia5 A G 16: 35,429,923 V222A possibly damaging Het
Plce1 G A 19: 38,725,051 probably null Het
Ppm1m T C 9: 106,197,228 R239G probably damaging Het
Prkcz A T 4: 155,268,195 F492I probably damaging Het
Rpl6 T C 5: 121,208,849 I269T possibly damaging Het
Scoc T C 8: 83,458,336 S2G unknown Het
Spesp1 A T 9: 62,272,639 M329K probably benign Het
Ston2 T C 12: 91,648,330 K435E probably damaging Het
Synj2 A T 17: 5,975,874 L69F probably damaging Het
Tigd5 T C 15: 75,909,993 I68T probably damaging Het
Tmcc2 A T 1: 132,358,982 M577K probably damaging Het
Tmem131l A T 3: 83,942,491 I263N possibly damaging Het
Trip13 T C 13: 73,913,320 E408G probably benign Het
Txnl4b T C 8: 109,569,103 probably null Het
Ube2o T C 11: 116,539,543 E1123G probably damaging Het
Vmn1r123 A G 7: 21,162,849 H222R possibly damaging Het
Vmn2r73 G T 7: 85,872,932 H66Q probably benign Het
Zc3h13 T A 14: 75,330,423 V1052D probably benign Het
Other mutations in Far1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Far1 APN 7 113540689 missense probably benign 0.07
IGL02597:Far1 APN 7 113551256 missense probably benign 0.31
IGL02937:Far1 APN 7 113540648 missense probably damaging 0.98
R0499:Far1 UTSW 7 113554296 intron probably benign
R2045:Far1 UTSW 7 113539271 critical splice acceptor site probably null
R2140:Far1 UTSW 7 113566460 missense possibly damaging 0.89
R2852:Far1 UTSW 7 113553737 missense possibly damaging 0.95
R2853:Far1 UTSW 7 113553737 missense possibly damaging 0.95
R4423:Far1 UTSW 7 113540598 missense probably damaging 1.00
R4426:Far1 UTSW 7 113550001 missense probably benign 0.08
R4801:Far1 UTSW 7 113539453 missense possibly damaging 0.77
R4802:Far1 UTSW 7 113539453 missense possibly damaging 0.77
R4898:Far1 UTSW 7 113568225 missense probably damaging 1.00
R5762:Far1 UTSW 7 113568189 missense probably damaging 0.98
R6151:Far1 UTSW 7 113561396 missense possibly damaging 0.60
R6165:Far1 UTSW 7 113554218 missense probably benign
R7269:Far1 UTSW 7 113561447 missense probably benign 0.00
R7356:Far1 UTSW 7 113568142 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACTGTCCAGTTGTAGGCAGATATG -3'
(R):5'- CCACGCTCCAATTTAAGATGG -3'

Sequencing Primer
(F):5'- AGGCAGATATGTTTGAAATGTGC -3'
(R):5'- TGTCTTAACAAAAGGTGAGATGTC -3'
Posted On2018-03-15