Incidental Mutation 'R6278:Ube2o'
ID507789
Institutional Source Beutler Lab
Gene Symbol Ube2o
Ensembl Gene ENSMUSG00000020802
Gene Nameubiquitin-conjugating enzyme E2O
SynonymsB230113M03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.574) question?
Stock #R6278 (G1)
Quality Score185.009
Status Validated
Chromosome11
Chromosomal Location116537740-116581447 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116539543 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1123 (E1123G)
Ref Sequence ENSEMBL: ENSMUSP00000080791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063396] [ENSMUST00000063446] [ENSMUST00000082152] [ENSMUST00000100201] [ENSMUST00000106386] [ENSMUST00000106387] [ENSMUST00000106388] [ENSMUST00000124682] [ENSMUST00000138840] [ENSMUST00000141798] [ENSMUST00000145737] [ENSMUST00000154034] [ENSMUST00000155102]
Predicted Effect probably benign
Transcript: ENSMUST00000063396
SMART Domains Protein: ENSMUSP00000064743
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 16 153 1.19e-8 SMART
low complexity region 257 263 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063446
SMART Domains Protein: ENSMUSP00000067865
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 16 153 1.19e-8 SMART
low complexity region 257 263 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000082152
AA Change: E1123G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080791
Gene: ENSMUSG00000020802
AA Change: E1123G

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
low complexity region 79 110 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
low complexity region 379 391 N/A INTRINSIC
low complexity region 470 505 N/A INTRINSIC
low complexity region 516 528 N/A INTRINSIC
low complexity region 705 712 N/A INTRINSIC
low complexity region 715 737 N/A INTRINSIC
coiled coil region 845 879 N/A INTRINSIC
UBCc 953 1110 2.23e-16 SMART
Blast:UBCc 1201 1274 1e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000100201
SMART Domains Protein: ENSMUSP00000097775
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 15 152 1.19e-8 SMART
low complexity region 256 262 N/A INTRINSIC
low complexity region 367 381 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106386
SMART Domains Protein: ENSMUSP00000101994
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 16 153 1.19e-8 SMART
low complexity region 257 263 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106387
SMART Domains Protein: ENSMUSP00000101995
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 16 153 1.19e-8 SMART
low complexity region 257 263 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106388
SMART Domains Protein: ENSMUSP00000101996
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 16 153 1.19e-8 SMART
low complexity region 257 263 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124682
SMART Domains Protein: ENSMUSP00000116055
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 16 153 1.19e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136526
Predicted Effect probably benign
Transcript: ENSMUST00000138840
SMART Domains Protein: ENSMUSP00000121064
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 15 152 1.19e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141798
SMART Domains Protein: ENSMUSP00000131010
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
DAGKc 22 159 1.19e-8 SMART
low complexity region 263 269 N/A INTRINSIC
low complexity region 374 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145737
SMART Domains Protein: ENSMUSP00000114622
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 15 152 1.19e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148185
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150658
Predicted Effect probably benign
Transcript: ENSMUST00000154034
SMART Domains Protein: ENSMUSP00000121219
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 15 152 1.19e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155102
SMART Domains Protein: ENSMUSP00000114819
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
Pfam:DAGK_cat 16 116 4.6e-27 PFAM
Meta Mutation Damage Score 0.222 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency 100% (49/49)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased MEF proliferation and transformation and increased pre-weaning lethality. Mice heterozygous for the allele exhibit increased total body fat amount, increased startle reflex, increased grip strength and increased circulating HDL cholesterol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 T C 7: 119,773,849 S192P probably damaging Het
Amy1 T A 3: 113,561,690 Y348F probably damaging Het
Brpf3 C A 17: 28,821,284 P893H probably benign Het
Cage1 T C 13: 38,016,419 T702A possibly damaging Het
Cdk11b A G 4: 155,649,603 probably benign Het
Cdk5rap3 T C 11: 96,911,903 Y207C probably damaging Het
Cenpc1 T C 5: 86,035,535 K465R probably damaging Het
Cldn14 A C 16: 93,919,598 L120R possibly damaging Het
Cyp2c69 A T 19: 39,843,063 C435* probably null Het
Dmxl2 T A 9: 54,415,762 E1446V probably damaging Het
Dnah17 T A 11: 118,126,290 D208V probably damaging Het
Eif4g3 G T 4: 138,188,083 G1430V possibly damaging Het
Eif5 T A 12: 111,542,793 D284E probably benign Het
Fam47e T C 5: 92,562,517 L125P probably damaging Het
Far1 A G 7: 113,568,137 I476M probably benign Het
Fsip2 A T 2: 82,988,898 I4992L probably benign Het
Gli3 T A 13: 15,725,113 N1028K possibly damaging Het
Gm13128 C T 4: 144,330,267 P7S probably damaging Het
Gucy1a1 T C 3: 82,097,634 K615E probably damaging Het
Gykl1 G T 18: 52,695,208 S496I probably benign Het
Hmcn1 C T 1: 150,697,419 probably null Het
Itga2 T A 13: 114,845,888 H1027L probably benign Het
Kif24 A T 4: 41,423,498 V251E probably damaging Het
Nupr1 T C 7: 126,625,346 Y30C probably damaging Het
Olfr1137 A T 2: 87,711,471 L145* probably null Het
Olfr1475 T A 19: 13,479,755 M148L probably benign Het
Olfr943 T A 9: 39,184,298 I40N probably damaging Het
Olfr998 A G 2: 85,590,998 I153V probably benign Het
P2ry1 T A 3: 61,003,794 I118N possibly damaging Het
Pcdh1 C T 18: 38,199,210 V247M probably benign Het
Pdia5 A G 16: 35,429,923 V222A possibly damaging Het
Plce1 G A 19: 38,725,051 probably null Het
Ppm1m T C 9: 106,197,228 R239G probably damaging Het
Prkcz A T 4: 155,268,195 F492I probably damaging Het
Rpl6 T C 5: 121,208,849 I269T possibly damaging Het
Scoc T C 8: 83,458,336 S2G unknown Het
Spesp1 A T 9: 62,272,639 M329K probably benign Het
Ston2 T C 12: 91,648,330 K435E probably damaging Het
Synj2 A T 17: 5,975,874 L69F probably damaging Het
Tigd5 T C 15: 75,909,993 I68T probably damaging Het
Tmcc2 A T 1: 132,358,982 M577K probably damaging Het
Tmem131l A T 3: 83,942,491 I263N possibly damaging Het
Trip13 T C 13: 73,913,320 E408G probably benign Het
Txnl4b T C 8: 109,569,103 probably null Het
Vmn1r123 A G 7: 21,162,849 H222R possibly damaging Het
Vmn2r73 G T 7: 85,872,932 H66Q probably benign Het
Zc3h13 T A 14: 75,330,423 V1052D probably benign Het
Other mutations in Ube2o
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ube2o APN 11 116544754 missense probably benign
IGL00973:Ube2o APN 11 116541205 missense probably damaging 1.00
IGL01291:Ube2o APN 11 116540134 missense probably damaging 1.00
IGL01804:Ube2o APN 11 116544373 missense probably benign 0.03
IGL02138:Ube2o APN 11 116543400 splice site probably benign
IGL02317:Ube2o APN 11 116541563 missense probably damaging 1.00
IGL02515:Ube2o APN 11 116543699 missense probably damaging 1.00
IGL02535:Ube2o APN 11 116541765 missense probably benign 0.00
IGL03062:Ube2o APN 11 116541642 missense probably damaging 0.99
IGL03145:Ube2o APN 11 116544009 missense probably damaging 1.00
IGL03190:Ube2o APN 11 116545128 missense probably damaging 1.00
ANU05:Ube2o UTSW 11 116540134 missense probably damaging 1.00
R0519:Ube2o UTSW 11 116546459 critical splice donor site probably null
R0666:Ube2o UTSW 11 116542835 missense probably damaging 1.00
R1056:Ube2o UTSW 11 116546464 missense probably damaging 1.00
R1202:Ube2o UTSW 11 116541582 missense probably damaging 1.00
R1424:Ube2o UTSW 11 116543732 missense probably benign
R1469:Ube2o UTSW 11 116545824 splice site probably benign
R1720:Ube2o UTSW 11 116544607 missense probably benign
R1791:Ube2o UTSW 11 116541494 missense probably benign 0.01
R1893:Ube2o UTSW 11 116548835 missense possibly damaging 0.68
R1997:Ube2o UTSW 11 116545337 missense probably damaging 0.99
R2156:Ube2o UTSW 11 116581146 missense probably damaging 0.98
R2199:Ube2o UTSW 11 116544745 missense probably benign
R2414:Ube2o UTSW 11 116548857 missense probably benign 0.02
R3766:Ube2o UTSW 11 116546863 splice site probably benign
R4749:Ube2o UTSW 11 116541908 missense probably benign 0.11
R5213:Ube2o UTSW 11 116541459 missense possibly damaging 0.82
R5403:Ube2o UTSW 11 116548807 missense possibly damaging 0.48
R5441:Ube2o UTSW 11 116544442 missense probably damaging 1.00
R5727:Ube2o UTSW 11 116539670 missense probably damaging 1.00
R6125:Ube2o UTSW 11 116541378 missense probably damaging 1.00
R6125:Ube2o UTSW 11 116544750 missense possibly damaging 0.50
R6234:Ube2o UTSW 11 116539490 missense probably benign 0.17
R6324:Ube2o UTSW 11 116539359 missense probably benign 0.00
R6346:Ube2o UTSW 11 116541368 missense probably damaging 1.00
R6389:Ube2o UTSW 11 116548858 missense probably null 0.72
R7040:Ube2o UTSW 11 116541860 missense probably benign 0.08
R7072:Ube2o UTSW 11 116541501 missense probably benign 0.13
R7270:Ube2o UTSW 11 116543935 missense possibly damaging 0.62
R7420:Ube2o UTSW 11 116540072 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATCTTCAGGCTCTTCACGG -3'
(R):5'- AGTCTGTCCTTTTGAGGGCCTC -3'

Sequencing Primer
(F):5'- GGCCGGAGTCTGAGAGTTC -3'
(R):5'- ACTCACTAAGGGACGCTTCCTG -3'
Posted On2018-03-15