Incidental Mutation 'R6278:Cldn14'
ID507799
Institutional Source Beutler Lab
Gene Symbol Cldn14
Ensembl Gene ENSMUSG00000047109
Gene Nameclaudin 14
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R6278 (G1)
Quality Score149.008
Status Validated
Chromosome16
Chromosomal Location93919031-94008837 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 93919598 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 120 (L120R)
Ref Sequence ENSEMBL: ENSMUSP00000136156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050962] [ENSMUST00000137163] [ENSMUST00000142083] [ENSMUST00000169391] [ENSMUST00000177648]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050962
AA Change: L120R

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000062045
Gene: ENSMUSG00000047109
AA Change: L120R

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 181 3.3e-31 PFAM
low complexity region 199 217 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137163
Predicted Effect probably benign
Transcript: ENSMUST00000142083
Predicted Effect possibly damaging
Transcript: ENSMUST00000169391
AA Change: L120R

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000126455
Gene: ENSMUSG00000047109
AA Change: L120R

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 181 3.3e-31 PFAM
Pfam:Claudin_2 15 183 1.1e-12 PFAM
low complexity region 199 217 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000177648
AA Change: L120R

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000136156
Gene: ENSMUSG00000047109
AA Change: L120R

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 181 3.3e-31 PFAM
Pfam:Claudin_2 15 183 1.1e-12 PFAM
low complexity region 199 217 N/A INTRINSIC
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: This gene encodes a member of the claudin family of tight junction proteins. The encoded protein is an integral membrane protein that may function in maintaining apical membrane polarization in tight junctions located between outer hair cells and supporting cells. Loss of function of this gene is associated with hearing problems. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutant mice have a normal endocochlear potential but are deaf due to cochlear hair cell degeneration within the first 3 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 T C 7: 119,773,849 S192P probably damaging Het
Amy1 T A 3: 113,561,690 Y348F probably damaging Het
Brpf3 C A 17: 28,821,284 P893H probably benign Het
Cage1 T C 13: 38,016,419 T702A possibly damaging Het
Cdk11b A G 4: 155,649,603 probably benign Het
Cdk5rap3 T C 11: 96,911,903 Y207C probably damaging Het
Cenpc1 T C 5: 86,035,535 K465R probably damaging Het
Cyp2c69 A T 19: 39,843,063 C435* probably null Het
Dmxl2 T A 9: 54,415,762 E1446V probably damaging Het
Dnah17 T A 11: 118,126,290 D208V probably damaging Het
Eif4g3 G T 4: 138,188,083 G1430V possibly damaging Het
Eif5 T A 12: 111,542,793 D284E probably benign Het
Fam47e T C 5: 92,562,517 L125P probably damaging Het
Far1 A G 7: 113,568,137 I476M probably benign Het
Fsip2 A T 2: 82,988,898 I4992L probably benign Het
Gli3 T A 13: 15,725,113 N1028K possibly damaging Het
Gm13128 C T 4: 144,330,267 P7S probably damaging Het
Gucy1a1 T C 3: 82,097,634 K615E probably damaging Het
Gykl1 G T 18: 52,695,208 S496I probably benign Het
Hmcn1 C T 1: 150,697,419 probably null Het
Itga2 T A 13: 114,845,888 H1027L probably benign Het
Kif24 A T 4: 41,423,498 V251E probably damaging Het
Nupr1 T C 7: 126,625,346 Y30C probably damaging Het
Olfr1137 A T 2: 87,711,471 L145* probably null Het
Olfr1475 T A 19: 13,479,755 M148L probably benign Het
Olfr943 T A 9: 39,184,298 I40N probably damaging Het
Olfr998 A G 2: 85,590,998 I153V probably benign Het
P2ry1 T A 3: 61,003,794 I118N possibly damaging Het
Pcdh1 C T 18: 38,199,210 V247M probably benign Het
Pdia5 A G 16: 35,429,923 V222A possibly damaging Het
Plce1 G A 19: 38,725,051 probably null Het
Ppm1m T C 9: 106,197,228 R239G probably damaging Het
Prkcz A T 4: 155,268,195 F492I probably damaging Het
Rpl6 T C 5: 121,208,849 I269T possibly damaging Het
Scoc T C 8: 83,458,336 S2G unknown Het
Spesp1 A T 9: 62,272,639 M329K probably benign Het
Ston2 T C 12: 91,648,330 K435E probably damaging Het
Synj2 A T 17: 5,975,874 L69F probably damaging Het
Tigd5 T C 15: 75,909,993 I68T probably damaging Het
Tmcc2 A T 1: 132,358,982 M577K probably damaging Het
Tmem131l A T 3: 83,942,491 I263N possibly damaging Het
Trip13 T C 13: 73,913,320 E408G probably benign Het
Txnl4b T C 8: 109,569,103 probably null Het
Ube2o T C 11: 116,539,543 E1123G probably damaging Het
Vmn1r123 A G 7: 21,162,849 H222R possibly damaging Het
Vmn2r73 G T 7: 85,872,932 H66Q probably benign Het
Zc3h13 T A 14: 75,330,423 V1052D probably benign Het
Other mutations in Cldn14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Cldn14 APN 16 93919301 missense probably benign 0.32
IGL02510:Cldn14 APN 16 93919956 start codon destroyed probably damaging 1.00
R1663:Cldn14 UTSW 16 93919278 missense probably damaging 1.00
R2939:Cldn14 UTSW 16 93919304 missense probably damaging 1.00
R3081:Cldn14 UTSW 16 93919304 missense probably damaging 1.00
R4887:Cldn14 UTSW 16 93919859 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCCTGGCAGGATAAGCAGAG -3'
(R):5'- ATCCTACCTGAAGGGACTGTGG -3'

Sequencing Primer
(F):5'- TAAGCAGAGCAGGGTGCCC -3'
(R):5'- GGCATCTACCAGTGTCAGATC -3'
Posted On2018-03-15