Incidental Mutation 'R6280:Slc12a6'
ID507873
Institutional Source Beutler Lab
Gene Symbol Slc12a6
Ensembl Gene ENSMUSG00000027130
Gene Namesolute carrier family 12, member 6
Synonymsgaxp, KCC3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.292) question?
Stock #R6280 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location112265825-112363163 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112337358 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 231 (T231A)
Ref Sequence ENSEMBL: ENSMUSP00000028549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028549] [ENSMUST00000053666] [ENSMUST00000110987] [ENSMUST00000110991] [ENSMUST00000141047]
Predicted Effect probably damaging
Transcript: ENSMUST00000028549
AA Change: T231A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028549
Gene: ENSMUSG00000027130
AA Change: T231A

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
SCOP:d1qqea_ 114 171 8e-3 SMART
Pfam:AA_permease 190 384 4.1e-25 PFAM
Pfam:AA_permease 453 761 2.3e-43 PFAM
Pfam:SLC12 773 897 7.1e-20 PFAM
Pfam:SLC12 892 1150 3.9e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053666
AA Change: T180A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000051490
Gene: ENSMUSG00000027130
AA Change: T180A

DomainStartEndE-ValueType
Pfam:AA_permease 139 333 2.3e-25 PFAM
Pfam:AA_permease_2 385 668 1.5e-19 PFAM
Pfam:AA_permease 391 710 4.5e-41 PFAM
low complexity region 828 842 N/A INTRINSIC
Pfam:KCl_Cotrans_1 967 996 2.2e-23 PFAM
low complexity region 1079 1091 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110987
AA Change: T216A

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106615
Gene: ENSMUSG00000027130
AA Change: T216A

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
SCOP:d1qqea_ 99 156 4e-3 SMART
Pfam:AA_permease 175 369 3.9e-25 PFAM
Pfam:AA_permease_2 421 704 3.2e-19 PFAM
Pfam:AA_permease 426 746 5.8e-41 PFAM
low complexity region 864 878 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110991
AA Change: T231A

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106619
Gene: ENSMUSG00000027130
AA Change: T231A

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
SCOP:d1qqea_ 114 171 7e-3 SMART
Pfam:AA_permease 190 384 4.2e-25 PFAM
Pfam:AA_permease_2 436 719 2.9e-19 PFAM
Pfam:AA_permease 442 761 8.2e-41 PFAM
low complexity region 879 893 N/A INTRINSIC
Pfam:KCl_Cotrans_1 1018 1047 2.7e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000141047
AA Change: T216A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124314
Gene: ENSMUSG00000096764
AA Change: T216A

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
SCOP:d1qqea_ 99 156 8e-3 SMART
Pfam:AA_permease 175 369 6.6e-25 PFAM
Pfam:AA_permease 438 746 3.6e-43 PFAM
Pfam:SLC12 758 884 6.8e-20 PFAM
Pfam:SLC12 877 1033 5.9e-20 PFAM
Meta Mutation Damage Score 0.292 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the K-Cl cotransporter (KCC) family. K-Cl cotransporters are integral membrane proteins that lower intracellular chloride concentrations below the electrochemical equilibrium potential. The proteins encoded by this gene are activated by cell swelling induced by hypotonic conditions. Alternate splicing results in multiple transcript variants encoding different isoforms. Mutations in this gene are associated with agenesis of the corpus callosum with peripheral neuropathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit locomotor deficits, progressive neurodegeneration, slow progressive deafness and failure to breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,327,057 S534P probably damaging Het
4930452B06Rik T G 14: 8,473,414 probably null Het
Abca12 C T 1: 71,272,460 D1930N probably benign Het
Adam8 A G 7: 139,984,807 L667S probably damaging Het
Adcy4 A T 14: 55,779,043 I317N probably damaging Het
Agpat3 A G 10: 78,285,038 F102S probably damaging Het
Apbb2 A T 5: 66,364,982 W443R probably damaging Het
BC049715 T A 6: 136,840,231 Y156* probably null Het
Bpifc C T 10: 85,977,712 V323I probably benign Het
Camp T G 9: 109,847,509 I149L probably benign Het
Cnih1 A G 14: 46,788,177 probably null Het
Col18a1 A T 10: 77,112,489 probably benign Het
Dsg4 A T 18: 20,466,667 D780V probably damaging Het
Dync1i1 G A 6: 5,972,084 V442I probably benign Het
Fam83g G T 11: 61,703,182 S514I probably benign Het
Fam92b A G 8: 120,172,119 I94T possibly damaging Het
Fbxo7 A G 10: 86,029,105 N93D probably benign Het
Fgf20 G T 8: 40,281,112 S76* probably null Het
Foxi1 A G 11: 34,207,972 F18L probably damaging Het
Fxr1 G A 3: 34,046,252 probably benign Het
Gon4l T A 3: 88,890,888 L800H probably damaging Het
Gpn3 T A 5: 122,373,959 S33T probably benign Het
Gria4 T C 9: 4,456,072 M743V probably damaging Het
Hira A G 16: 18,910,707 N109D probably damaging Het
Hsd3b3 A G 3: 98,753,305 probably null Het
Hsf2 T G 10: 57,511,495 S370A probably benign Het
Htt T A 5: 34,870,759 D1786E probably benign Het
Ifit1bl2 T A 19: 34,620,134 R27S possibly damaging Het
Il17rb G A 14: 30,002,971 A186V probably benign Het
Irak4 G T 15: 94,551,810 E57* probably null Het
Kcnh2 T A 5: 24,331,923 H221L probably benign Het
Kdm2b T C 5: 122,878,624 N1149D probably damaging Het
Kif26a A G 12: 112,174,869 H702R probably damaging Het
Kmt2e T C 5: 23,499,516 S1236P possibly damaging Het
Krt77 T A 15: 101,865,475 D248V probably damaging Het
Lgals3bp T C 11: 118,393,280 N52S possibly damaging Het
Lhfp T C 3: 53,260,514 Y170H probably damaging Het
Lpin2 A G 17: 71,232,248 probably benign Het
Lrig3 T C 10: 126,010,979 I872T probably benign Het
Lrit3 T C 3: 129,788,763 E525G probably damaging Het
Lrp1 T C 10: 127,589,584 T726A probably benign Het
Mep1a A T 17: 43,502,392 N46K probably damaging Het
Muc16 C A 9: 18,579,317 probably null Het
N4bp1 A C 8: 86,853,166 N669K possibly damaging Het
Nelfcd A G 2: 174,415,946 D26G probably benign Het
Neu4 G A 1: 94,025,151 S414N probably damaging Het
Nudt9 A G 5: 104,065,069 D336G probably benign Het
Obscn C A 11: 59,063,683 G3691V possibly damaging Het
Olfr1102 A G 2: 87,002,020 N17S probably damaging Het
Olfr1263 A C 2: 90,015,049 I40L possibly damaging Het
Pdgfd T A 9: 6,288,627 S94T probably benign Het
Picalm A G 7: 90,177,562 H290R probably benign Het
Pou2f3 A T 9: 43,139,339 L242Q probably damaging Het
Pou2f3 G T 9: 43,139,340 L242M probably damaging Het
Prkd3 C T 17: 78,981,931 G187D probably damaging Het
Pwp1 A G 10: 85,874,462 S49G probably damaging Het
Ralgapa2 A G 2: 146,342,209 L1626P probably damaging Het
Rin2 A G 2: 145,861,019 Y545C probably damaging Het
Rwdd4a A G 8: 47,542,797 T71A probably benign Het
Senp7 T C 16: 56,162,375 F504L possibly damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc17a2 A G 13: 23,822,394 S468G probably benign Het
Slc4a10 A G 2: 62,281,966 N697S probably benign Het
Spint1 T A 2: 119,245,278 V194E possibly damaging Het
Sptlc2 A T 12: 87,388,131 M14K probably benign Het
Stard9 A G 2: 120,701,127 K2622E probably benign Het
Tbc1d5 T C 17: 50,782,310 N614S probably benign Het
Tdpoz2 A T 3: 93,651,883 C261S probably benign Het
Tmem150b A T 7: 4,724,374 I44N probably benign Het
Ttn A G 2: 76,778,158 L17807P probably damaging Het
Vcan G A 13: 89,725,373 R121W probably damaging Het
Vmn2r15 T A 5: 109,293,425 H189L possibly damaging Het
Vmn2r19 A G 6: 123,336,253 S761G probably benign Het
Wdr11 A T 7: 129,599,106 K34* probably null Het
Zfp120 A T 2: 150,118,044 S141R possibly damaging Het
Zfp462 C G 4: 55,010,253 P740A probably benign Het
Other mutations in Slc12a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01488:Slc12a6 APN 2 112353064 splice site probably null
IGL02573:Slc12a6 APN 2 112358641 critical splice donor site probably null
R0548:Slc12a6 UTSW 2 112335924 critical splice donor site probably null
R1495:Slc12a6 UTSW 2 112354190 missense probably damaging 0.99
R1726:Slc12a6 UTSW 2 112347426 missense probably damaging 1.00
R1856:Slc12a6 UTSW 2 112335927 splice site probably null
R1958:Slc12a6 UTSW 2 112355158 missense possibly damaging 0.92
R2112:Slc12a6 UTSW 2 112356485 missense probably damaging 1.00
R2865:Slc12a6 UTSW 2 112347317 missense probably benign 0.09
R3888:Slc12a6 UTSW 2 112267030 missense possibly damaging 0.76
R4412:Slc12a6 UTSW 2 112335888 missense possibly damaging 0.95
R4655:Slc12a6 UTSW 2 112357766 critical splice acceptor site probably null
R4669:Slc12a6 UTSW 2 112354295 missense probably damaging 1.00
R4928:Slc12a6 UTSW 2 112352961 missense probably damaging 1.00
R4974:Slc12a6 UTSW 2 112358525 missense probably damaging 1.00
R5016:Slc12a6 UTSW 2 112356627 intron probably benign
R5372:Slc12a6 UTSW 2 112347360 nonsense probably null
R5405:Slc12a6 UTSW 2 112339379 missense probably damaging 1.00
R5786:Slc12a6 UTSW 2 112284722 missense probably benign 0.01
R5836:Slc12a6 UTSW 2 112341998 missense possibly damaging 0.62
R6310:Slc12a6 UTSW 2 112335839 missense probably damaging 1.00
R6525:Slc12a6 UTSW 2 112352451 missense probably damaging 1.00
R6597:Slc12a6 UTSW 2 112352935 missense probably damaging 1.00
R6723:Slc12a6 UTSW 2 112337942 missense probably damaging 1.00
R6895:Slc12a6 UTSW 2 112355095 missense probably damaging 1.00
R7059:Slc12a6 UTSW 2 112352912 missense probably damaging 0.99
R7188:Slc12a6 UTSW 2 112334415 missense probably benign 0.04
R7395:Slc12a6 UTSW 2 112352542 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTAGTCTGTAGGTAGGTTCACC -3'
(R):5'- CCTTAAGCTAAACAGCATTTGTCTCTC -3'

Sequencing Primer
(F):5'- AGGTTCACCCTACCTTGCAATGTTAG -3'
(R):5'- AAACAGCATTTGTCTCTCTGGCTTG -3'
Posted On2018-03-15