Incidental Mutation 'R6280:Kcnh2'
ID507887
Institutional Source Beutler Lab
Gene Symbol Kcnh2
Ensembl Gene ENSMUSG00000038319
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 2
Synonymsmerg1a, M-erg, Lqt2, ERG1, ether a go-go related, merg1b, LQT
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.576) question?
Stock #R6280 (G1)
Quality Score191.009
Status Validated
Chromosome5
Chromosomal Location24319589-24351604 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24331923 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 221 (H221L)
Ref Sequence ENSEMBL: ENSMUSP00000047705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036092] [ENSMUST00000115098]
Predicted Effect probably benign
Transcript: ENSMUST00000036092
AA Change: H221L

PolyPhen 2 Score 0.432 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000047705
Gene: ENSMUSG00000038319
AA Change: H221L

DomainStartEndE-ValueType
PAS 13 87 9.54e0 SMART
PAC 93 135 1.31e-5 SMART
low complexity region 194 199 N/A INTRINSIC
Pfam:Ion_trans 409 673 7.8e-38 PFAM
Pfam:Ion_trans_2 600 667 3.2e-13 PFAM
cNMP 744 862 1.15e-24 SMART
low complexity region 885 896 N/A INTRINSIC
low complexity region 925 956 N/A INTRINSIC
low complexity region 965 982 N/A INTRINSIC
coiled coil region 1035 1069 N/A INTRINSIC
low complexity region 1082 1108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115098
SMART Domains Protein: ENSMUSP00000110750
Gene: ENSMUSG00000038319

DomainStartEndE-ValueType
Pfam:Ion_trans 114 319 1.4e-22 PFAM
Pfam:Ion_trans_2 257 325 2.9e-14 PFAM
cNMP 402 520 1.15e-24 SMART
low complexity region 543 554 N/A INTRINSIC
low complexity region 583 614 N/A INTRINSIC
low complexity region 623 640 N/A INTRINSIC
coiled coil region 693 727 N/A INTRINSIC
low complexity region 740 766 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144193
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-activated potassium channel belonging to the eag family. It shares sequence similarity with the Drosophila ether-a-go-go (eag) gene. Mutations in this gene can cause long QT syndrome type 2 (LQT2). Transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice which maintain expression of the A isoform and lack expression of the B isoform are predisposed to episodic sinus bradycardia. Mice with mutations causing defects in both isoforms are embryonic lethal with defects in cardiac development and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,327,057 S534P probably damaging Het
4930452B06Rik T G 14: 8,473,414 probably null Het
Abca12 C T 1: 71,272,460 D1930N probably benign Het
Adam8 A G 7: 139,984,807 L667S probably damaging Het
Adcy4 A T 14: 55,779,043 I317N probably damaging Het
Agpat3 A G 10: 78,285,038 F102S probably damaging Het
Apbb2 A T 5: 66,364,982 W443R probably damaging Het
BC049715 T A 6: 136,840,231 Y156* probably null Het
Bpifc C T 10: 85,977,712 V323I probably benign Het
Camp T G 9: 109,847,509 I149L probably benign Het
Cnih1 A G 14: 46,788,177 probably null Het
Col18a1 A T 10: 77,112,489 probably benign Het
Dsg4 A T 18: 20,466,667 D780V probably damaging Het
Dync1i1 G A 6: 5,972,084 V442I probably benign Het
Fam83g G T 11: 61,703,182 S514I probably benign Het
Fam92b A G 8: 120,172,119 I94T possibly damaging Het
Fbxo7 A G 10: 86,029,105 N93D probably benign Het
Fgf20 G T 8: 40,281,112 S76* probably null Het
Foxi1 A G 11: 34,207,972 F18L probably damaging Het
Fxr1 G A 3: 34,046,252 probably benign Het
Gon4l T A 3: 88,890,888 L800H probably damaging Het
Gpn3 T A 5: 122,373,959 S33T probably benign Het
Gria4 T C 9: 4,456,072 M743V probably damaging Het
Hira A G 16: 18,910,707 N109D probably damaging Het
Hsd3b3 A G 3: 98,753,305 probably null Het
Hsf2 T G 10: 57,511,495 S370A probably benign Het
Htt T A 5: 34,870,759 D1786E probably benign Het
Ifit1bl2 T A 19: 34,620,134 R27S possibly damaging Het
Il17rb G A 14: 30,002,971 A186V probably benign Het
Irak4 G T 15: 94,551,810 E57* probably null Het
Kdm2b T C 5: 122,878,624 N1149D probably damaging Het
Kif26a A G 12: 112,174,869 H702R probably damaging Het
Kmt2e T C 5: 23,499,516 S1236P possibly damaging Het
Krt77 T A 15: 101,865,475 D248V probably damaging Het
Lgals3bp T C 11: 118,393,280 N52S possibly damaging Het
Lhfp T C 3: 53,260,514 Y170H probably damaging Het
Lpin2 A G 17: 71,232,248 probably benign Het
Lrig3 T C 10: 126,010,979 I872T probably benign Het
Lrit3 T C 3: 129,788,763 E525G probably damaging Het
Lrp1 T C 10: 127,589,584 T726A probably benign Het
Mep1a A T 17: 43,502,392 N46K probably damaging Het
Muc16 C A 9: 18,579,317 probably null Het
N4bp1 A C 8: 86,853,166 N669K possibly damaging Het
Nelfcd A G 2: 174,415,946 D26G probably benign Het
Neu4 G A 1: 94,025,151 S414N probably damaging Het
Nudt9 A G 5: 104,065,069 D336G probably benign Het
Obscn C A 11: 59,063,683 G3691V possibly damaging Het
Olfr1102 A G 2: 87,002,020 N17S probably damaging Het
Olfr1263 A C 2: 90,015,049 I40L possibly damaging Het
Pdgfd T A 9: 6,288,627 S94T probably benign Het
Picalm A G 7: 90,177,562 H290R probably benign Het
Pou2f3 A T 9: 43,139,339 L242Q probably damaging Het
Pou2f3 G T 9: 43,139,340 L242M probably damaging Het
Prkd3 C T 17: 78,981,931 G187D probably damaging Het
Pwp1 A G 10: 85,874,462 S49G probably damaging Het
Ralgapa2 A G 2: 146,342,209 L1626P probably damaging Het
Rin2 A G 2: 145,861,019 Y545C probably damaging Het
Rwdd4a A G 8: 47,542,797 T71A probably benign Het
Senp7 T C 16: 56,162,375 F504L possibly damaging Het
Slc12a6 A G 2: 112,337,358 T231A probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc17a2 A G 13: 23,822,394 S468G probably benign Het
Slc4a10 A G 2: 62,281,966 N697S probably benign Het
Spint1 T A 2: 119,245,278 V194E possibly damaging Het
Sptlc2 A T 12: 87,388,131 M14K probably benign Het
Stard9 A G 2: 120,701,127 K2622E probably benign Het
Tbc1d5 T C 17: 50,782,310 N614S probably benign Het
Tdpoz2 A T 3: 93,651,883 C261S probably benign Het
Tmem150b A T 7: 4,724,374 I44N probably benign Het
Ttn A G 2: 76,778,158 L17807P probably damaging Het
Vcan G A 13: 89,725,373 R121W probably damaging Het
Vmn2r15 T A 5: 109,293,425 H189L possibly damaging Het
Vmn2r19 A G 6: 123,336,253 S761G probably benign Het
Wdr11 A T 7: 129,599,106 K34* probably null Het
Zfp120 A T 2: 150,118,044 S141R possibly damaging Het
Zfp462 C G 4: 55,010,253 P740A probably benign Het
Other mutations in Kcnh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Kcnh2 APN 5 24324966 missense probably damaging 1.00
IGL01536:Kcnh2 APN 5 24326524 missense probably damaging 1.00
IGL02305:Kcnh2 APN 5 24322660 missense possibly damaging 0.86
IGL02379:Kcnh2 APN 5 24326638 missense probably damaging 1.00
IGL03100:Kcnh2 APN 5 24322684 missense probably damaging 1.00
IGL03326:Kcnh2 APN 5 24326413 missense probably damaging 1.00
R0077:Kcnh2 UTSW 5 24322702 missense probably benign 0.11
R0349:Kcnh2 UTSW 5 24351237 missense probably benign 0.18
R0959:Kcnh2 UTSW 5 24322672 missense probably damaging 1.00
R0960:Kcnh2 UTSW 5 24322672 missense probably damaging 1.00
R0963:Kcnh2 UTSW 5 24322672 missense probably damaging 1.00
R1130:Kcnh2 UTSW 5 24331825 nonsense probably null
R1147:Kcnh2 UTSW 5 24324387 missense probably damaging 1.00
R1147:Kcnh2 UTSW 5 24324387 missense probably damaging 1.00
R1201:Kcnh2 UTSW 5 24322672 missense probably damaging 1.00
R1346:Kcnh2 UTSW 5 24322660 missense possibly damaging 0.86
R1608:Kcnh2 UTSW 5 24322219 missense probably benign
R1613:Kcnh2 UTSW 5 24322762 splice site probably benign
R1797:Kcnh2 UTSW 5 24322672 missense probably damaging 1.00
R2006:Kcnh2 UTSW 5 24326570 missense probably damaging 1.00
R2312:Kcnh2 UTSW 5 24324954 critical splice donor site probably null
R2435:Kcnh2 UTSW 5 24326347 critical splice donor site probably null
R4623:Kcnh2 UTSW 5 24348442 missense probably benign 0.00
R4941:Kcnh2 UTSW 5 24331087 missense probably damaging 0.98
R5394:Kcnh2 UTSW 5 24332041 missense probably benign
R5467:Kcnh2 UTSW 5 24326767 nonsense probably null
R6127:Kcnh2 UTSW 5 24325003 missense probably damaging 1.00
R6135:Kcnh2 UTSW 5 24321793 missense probably damaging 1.00
R6936:Kcnh2 UTSW 5 24324339 missense probably damaging 1.00
R7061:Kcnh2 UTSW 5 24331922 missense probably benign 0.01
R7136:Kcnh2 UTSW 5 24332991 missense probably benign 0.13
R7399:Kcnh2 UTSW 5 24322059 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATTGCCTCAATGTCATCCGCG -3'
(R):5'- CCAAGACTTTCCGCCTGAAG -3'

Sequencing Primer
(F):5'- TTAAGGCTCTGAGCTCGT -3'
(R):5'- TGAAGCTGCCTGCCTTG -3'
Posted On2018-03-15