Incidental Mutation 'R6281:Gabra2'
ID507951
Institutional Source Beutler Lab
Gene Symbol Gabra2
Ensembl Gene ENSMUSG00000000560
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit alpha 2
SynonymsC630048P16Rik, Gabra-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R6281 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location70957597-71095849 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71034762 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 75 (T75A)
Ref Sequence ENSEMBL: ENSMUSP00000142892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000572] [ENSMUST00000197284] [ENSMUST00000198625]
Predicted Effect probably benign
Transcript: ENSMUST00000000572
SMART Domains Protein: ENSMUSP00000000572
Gene: ENSMUSG00000000560

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Neur_chan_LBD 42 250 1.9e-51 PFAM
Pfam:Neur_chan_memb 257 344 1.2e-32 PFAM
low complexity region 364 375 N/A INTRINSIC
low complexity region 392 410 N/A INTRINSIC
transmembrane domain 423 440 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197284
AA Change: T75A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142892
Gene: ENSMUSG00000000560
AA Change: T75A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Neur_chan_LBD 42 250 2.7e-53 PFAM
Pfam:Neur_chan_memb 257 354 5.6e-38 PFAM
Pfam:Neur_chan_memb 343 437 1e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000198625
AA Change: T75A

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143645
Gene: ENSMUSG00000000560
AA Change: T75A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
SCOP:d1i9ba_ 47 87 7e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199861
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. At least 16 distinct subunits of GABA-A receptors have been identified. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knockout allele are resistant to the anxiolytic effects of diazepam (DZP). Mice homozygous for a different knock-out allele exhibit reduced DZP-induced antihyperalgesia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik C A 8: 121,531,881 C166F probably damaging Het
Aida C T 1: 183,322,290 A237V probably damaging Het
Ankib1 T C 5: 3,701,965 T692A possibly damaging Het
As3mt T C 19: 46,724,923 V303A possibly damaging Het
Bhlhe40 T A 6: 108,664,462 probably null Het
Bhmt2 G A 13: 93,663,160 P256L probably damaging Het
Bpifb1 T C 2: 154,206,465 I140T probably damaging Het
Cat A T 2: 103,471,769 H194Q probably damaging Het
Cbfa2t3 C A 8: 122,633,409 R466L probably damaging Het
Fancm T C 12: 65,088,270 V279A probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm3512 T A 14: 7,159,254 D7V possibly damaging Het
Gpr15 A G 16: 58,718,594 F44S probably damaging Het
Ighv1-72 C A 12: 115,758,403 C5F probably benign Het
Lilra6 A G 7: 3,911,973 L474P probably damaging Het
Mboat2 T C 12: 24,957,679 V297A probably benign Het
Muc2 C G 7: 141,752,403 C276W probably damaging Het
Ncor1 T C 11: 62,373,545 S141G possibly damaging Het
Olfr1283 T C 2: 111,369,549 *306R probably null Het
Olfr508 T G 7: 108,630,402 S137A probably benign Het
Pax5 T G 4: 44,691,955 E97A probably benign Het
Pcdhga11 A T 18: 37,757,373 D478V probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phf21b G T 15: 84,854,745 D38E probably benign Het
Ptcd1 T C 5: 145,165,071 K146R probably benign Het
Rad23a A T 8: 84,838,110 M166K probably damaging Het
Rfc4 A T 16: 23,118,066 probably null Het
Slc17a3 T A 13: 23,856,799 I336N probably benign Het
Slc2a12 T A 10: 22,665,320 M358K probably damaging Het
Stk31 T G 6: 49,469,180 M939R possibly damaging Het
Tecrl T A 5: 83,294,606 T167S probably damaging Het
Tfap2d G C 1: 19,104,478 G52R probably benign Het
Ttn C T 2: 76,941,828 V2577M probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vezt G A 10: 93,973,946 R578C probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vwa3b T A 1: 37,123,982 L562Q probably damaging Het
Zfyve27 T A 19: 42,182,755 N127K probably damaging Het
Znfx1 A G 2: 167,055,885 F373S probably damaging Het
Zswim8 G A 14: 20,714,640 V693I probably benign Het
Other mutations in Gabra2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Gabra2 APN 5 70962072 missense probably benign
IGL01084:Gabra2 APN 5 71006233 missense probably damaging 1.00
IGL01948:Gabra2 APN 5 70961885 missense probably damaging 1.00
IGL01965:Gabra2 APN 5 71008075 splice site probably benign
IGL03263:Gabra2 APN 5 70973493 missense probably damaging 1.00
R0005:Gabra2 UTSW 5 70973436 missense probably benign 0.00
R0751:Gabra2 UTSW 5 71092099 splice site probably benign
R1025:Gabra2 UTSW 5 70973595 missense probably damaging 1.00
R1713:Gabra2 UTSW 5 71014563 missense probably benign 0.24
R1964:Gabra2 UTSW 5 71014450 missense possibly damaging 0.91
R3861:Gabra2 UTSW 5 70973543 missense probably damaging 1.00
R4190:Gabra2 UTSW 5 71007998 missense probably benign 0.00
R4192:Gabra2 UTSW 5 71007998 missense probably benign 0.00
R4193:Gabra2 UTSW 5 71007998 missense probably benign 0.00
R6419:Gabra2 UTSW 5 70962083 missense probably benign 0.00
R6814:Gabra2 UTSW 5 71094539 missense probably damaging 1.00
R6872:Gabra2 UTSW 5 71094539 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCACTTCGCAGCTAAGTAAG -3'
(R):5'- AGATGAATGTCAAATACTTCTTGGC -3'

Sequencing Primer
(F):5'- CCACTTCGCAGCTAAGTAAGTATATG -3'
(R):5'- CTTCTTGGCATTAATTCTGTTAGTTG -3'
Posted On2018-03-15