Incidental Mutation 'R6281:Bhlhe40'
ID507956
Institutional Source Beutler Lab
Gene Symbol Bhlhe40
Ensembl Gene ENSMUSG00000030103
Gene Namebasic helix-loop-helix family, member e40
SynonymsStra13, C130042M06Rik, eip1 (E47 interaction protein 1), Sharp2, Stra14, DEC1, Bhlhb2, cytokine response gene 8, CR8, Clast5
MMRRC Submission
Accession Numbers

Genbank: NM_011498; MGI: 1097714

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6281 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location108660629-108666925 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 108664462 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000032194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032194] [ENSMUST00000163617]
Predicted Effect probably null
Transcript: ENSMUST00000032194
SMART Domains Protein: ENSMUSP00000032194
Gene: ENSMUSG00000030103

DomainStartEndE-ValueType
HLH 58 113 2.52e-11 SMART
ORANGE 140 184 5.91e-13 SMART
low complexity region 230 248 N/A INTRINSIC
low complexity region 372 399 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137478
Predicted Effect probably benign
Transcript: ENSMUST00000163617
SMART Domains Protein: ENSMUSP00000132157
Gene: ENSMUSG00000030103

DomainStartEndE-ValueType
HLH 58 113 2.52e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204397
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204550
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: This gene encodes a basic helix-loop-helix protein expressed in various tissues. The encoded protein can interact with Arntl or compete for E-box binding sites in the promoter of Per1 and repress Clock/Arntl's transactivation of Per1. This gene is believed to be involved in the control of circadian rhythm and cell differentiation. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutation of this gene results in impaired immune function and hyperplasia of the lymphoid organs. Aging mutant animals exhibit autoimmune disease. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik C A 8: 121,531,881 C166F probably damaging Het
Aida C T 1: 183,322,290 A237V probably damaging Het
Ankib1 T C 5: 3,701,965 T692A possibly damaging Het
As3mt T C 19: 46,724,923 V303A possibly damaging Het
Bhmt2 G A 13: 93,663,160 P256L probably damaging Het
Bpifb1 T C 2: 154,206,465 I140T probably damaging Het
Cat A T 2: 103,471,769 H194Q probably damaging Het
Cbfa2t3 C A 8: 122,633,409 R466L probably damaging Het
Fancm T C 12: 65,088,270 V279A probably damaging Het
Gabra2 T C 5: 71,034,762 T75A probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm3512 T A 14: 7,159,254 D7V possibly damaging Het
Gpr15 A G 16: 58,718,594 F44S probably damaging Het
Ighv1-72 C A 12: 115,758,403 C5F probably benign Het
Lilra6 A G 7: 3,911,973 L474P probably damaging Het
Mboat2 T C 12: 24,957,679 V297A probably benign Het
Muc2 C G 7: 141,752,403 C276W probably damaging Het
Ncor1 T C 11: 62,373,545 S141G possibly damaging Het
Olfr1283 T C 2: 111,369,549 *306R probably null Het
Olfr508 T G 7: 108,630,402 S137A probably benign Het
Pax5 T G 4: 44,691,955 E97A probably benign Het
Pcdhga11 A T 18: 37,757,373 D478V probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phf21b G T 15: 84,854,745 D38E probably benign Het
Ptcd1 T C 5: 145,165,071 K146R probably benign Het
Rad23a A T 8: 84,838,110 M166K probably damaging Het
Rfc4 A T 16: 23,118,066 probably null Het
Slc17a3 T A 13: 23,856,799 I336N probably benign Het
Slc2a12 T A 10: 22,665,320 M358K probably damaging Het
Stk31 T G 6: 49,469,180 M939R possibly damaging Het
Tecrl T A 5: 83,294,606 T167S probably damaging Het
Tfap2d G C 1: 19,104,478 G52R probably benign Het
Ttn C T 2: 76,941,828 V2577M probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vezt G A 10: 93,973,946 R578C probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vwa3b T A 1: 37,123,982 L562Q probably damaging Het
Zfyve27 T A 19: 42,182,755 N127K probably damaging Het
Znfx1 A G 2: 167,055,885 F373S probably damaging Het
Zswim8 G A 14: 20,714,640 V693I probably benign Het
Other mutations in Bhlhe40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Bhlhe40 APN 6 108661178 missense probably benign 0.25
IGL01146:Bhlhe40 APN 6 108664940 missense possibly damaging 0.60
IGL02950:Bhlhe40 APN 6 108664542 missense probably damaging 1.00
teedoff UTSW 6 108664857 frame shift probably null
R0360:Bhlhe40 UTSW 6 108664750 missense probably damaging 1.00
R1486:Bhlhe40 UTSW 6 108664929 missense probably damaging 1.00
R5041:Bhlhe40 UTSW 6 108662585 missense probably damaging 0.99
R5179:Bhlhe40 UTSW 6 108665208 missense possibly damaging 0.55
R5913:Bhlhe40 UTSW 6 108665193 missense possibly damaging 0.79
R6283:Bhlhe40 UTSW 6 108665031 missense probably damaging 1.00
R6405:Bhlhe40 UTSW 6 108664857 frame shift probably null
R6406:Bhlhe40 UTSW 6 108664857 frame shift probably null
R6595:Bhlhe40 UTSW 6 108664857 frame shift probably null
R6654:Bhlhe40 UTSW 6 108664857 frame shift probably null
R6656:Bhlhe40 UTSW 6 108664857 frame shift probably null
R6657:Bhlhe40 UTSW 6 108664857 frame shift probably null
R6659:Bhlhe40 UTSW 6 108664857 frame shift probably null
R6734:Bhlhe40 UTSW 6 108664857 frame shift probably null
R6968:Bhlhe40 UTSW 6 108664857 frame shift probably null
R7105:Bhlhe40 UTSW 6 108665036 missense possibly damaging 0.96
R7323:Bhlhe40 UTSW 6 108665281 missense probably benign 0.42
R7395:Bhlhe40 UTSW 6 108664857 frame shift probably null
R7399:Bhlhe40 UTSW 6 108664857 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AAAACCCTGTAACTAAGTGGTCGG -3'
(R):5'- TTTGGGAGCCGAGTCCAATG -3'

Sequencing Primer
(F):5'- CCCTGTAACTAAGTGGTCGGAATTTG -3'
(R):5'- AATGGTTTCCTGGAAGCACC -3'
Posted On2018-03-15