Incidental Mutation 'R6281:Bhlhe40'
ID 507956
Institutional Source Beutler Lab
Gene Symbol Bhlhe40
Ensembl Gene ENSMUSG00000030103
Gene Name basic helix-loop-helix family, member e40
Synonyms C130042M06Rik, Clast5, DEC1, CR8, Stra14, cytokine response gene 8, Sharp2, eip1 (E47 interaction protein 1), Bhlhb2, Stra13
MMRRC Submission 044451-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6281 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 108637590-108643886 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 108641423 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000032194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032194] [ENSMUST00000163617]
AlphaFold O35185
Predicted Effect probably null
Transcript: ENSMUST00000032194
SMART Domains Protein: ENSMUSP00000032194
Gene: ENSMUSG00000030103

DomainStartEndE-ValueType
HLH 58 113 2.52e-11 SMART
ORANGE 140 184 5.91e-13 SMART
low complexity region 230 248 N/A INTRINSIC
low complexity region 372 399 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137478
Predicted Effect probably benign
Transcript: ENSMUST00000163617
SMART Domains Protein: ENSMUSP00000132157
Gene: ENSMUSG00000030103

DomainStartEndE-ValueType
HLH 58 113 2.52e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204397
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204550
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: This gene encodes a basic helix-loop-helix protein expressed in various tissues. The encoded protein can interact with Arntl or compete for E-box binding sites in the promoter of Per1 and repress Clock/Arntl's transactivation of Per1. This gene is believed to be involved in the control of circadian rhythm and cell differentiation. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutation of this gene results in impaired immune function and hyperplasia of the lymphoid organs. Aging mutant animals exhibit autoimmune disease. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik C A 8: 122,258,620 (GRCm39) C166F probably damaging Het
Aida C T 1: 183,103,145 (GRCm39) A237V probably damaging Het
Ankib1 T C 5: 3,751,965 (GRCm39) T692A possibly damaging Het
As3mt T C 19: 46,713,362 (GRCm39) V303A possibly damaging Het
Bhmt2 G A 13: 93,799,668 (GRCm39) P256L probably damaging Het
Bpifb1 T C 2: 154,048,385 (GRCm39) I140T probably damaging Het
Cat A T 2: 103,302,114 (GRCm39) H194Q probably damaging Het
Cbfa2t3 C A 8: 123,360,148 (GRCm39) R466L probably damaging Het
Fancm T C 12: 65,135,044 (GRCm39) V279A probably damaging Het
Gabra2 T C 5: 71,192,105 (GRCm39) T75A probably damaging Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
Gm3512 T A 14: 7,159,254 (GRCm38) D7V possibly damaging Het
Gpr15 A G 16: 58,538,957 (GRCm39) F44S probably damaging Het
Ighv1-72 C A 12: 115,722,023 (GRCm39) C5F probably benign Het
Lilra6 A G 7: 3,914,972 (GRCm39) L474P probably damaging Het
Mboat2 T C 12: 25,007,678 (GRCm39) V297A probably benign Het
Muc2 C G 7: 141,306,140 (GRCm39) C276W probably damaging Het
Ncor1 T C 11: 62,264,371 (GRCm39) S141G possibly damaging Het
Or4k77 T C 2: 111,199,894 (GRCm39) *306R probably null Het
Or5p80 T G 7: 108,229,609 (GRCm39) S137A probably benign Het
Pax5 T G 4: 44,691,955 (GRCm39) E97A probably benign Het
Pcdhga11 A T 18: 37,890,426 (GRCm39) D478V probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 (GRCm39) probably benign Het
Phf21b G T 15: 84,738,946 (GRCm39) D38E probably benign Het
Ptcd1 T C 5: 145,101,881 (GRCm39) K146R probably benign Het
Rad23a A T 8: 85,564,739 (GRCm39) M166K probably damaging Het
Rfc4 A T 16: 22,936,816 (GRCm39) probably null Het
Slc17a3 T A 13: 24,040,782 (GRCm39) I336N probably benign Het
Slc2a12 T A 10: 22,541,219 (GRCm39) M358K probably damaging Het
Stk31 T G 6: 49,446,114 (GRCm39) M939R possibly damaging Het
Tecrl T A 5: 83,442,453 (GRCm39) T167S probably damaging Het
Tfap2d G C 1: 19,174,702 (GRCm39) G52R probably benign Het
Ttn C T 2: 76,772,172 (GRCm39) V2577M probably damaging Het
Uox C T 3: 146,330,332 (GRCm39) R163* probably null Het
Vezt G A 10: 93,809,808 (GRCm39) R578C probably benign Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Vwa3b T A 1: 37,163,063 (GRCm39) L562Q probably damaging Het
Zfyve27 T A 19: 42,171,194 (GRCm39) N127K probably damaging Het
Znfx1 A G 2: 166,897,805 (GRCm39) F373S probably damaging Het
Zswim8 G A 14: 20,764,708 (GRCm39) V693I probably benign Het
Other mutations in Bhlhe40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Bhlhe40 APN 6 108,638,139 (GRCm39) missense probably benign 0.25
IGL01146:Bhlhe40 APN 6 108,641,901 (GRCm39) missense possibly damaging 0.60
IGL02950:Bhlhe40 APN 6 108,641,503 (GRCm39) missense probably damaging 1.00
teedoff UTSW 6 108,641,818 (GRCm39) frame shift probably null
R0360:Bhlhe40 UTSW 6 108,641,711 (GRCm39) missense probably damaging 1.00
R1486:Bhlhe40 UTSW 6 108,641,890 (GRCm39) missense probably damaging 1.00
R5041:Bhlhe40 UTSW 6 108,639,546 (GRCm39) missense probably damaging 0.99
R5179:Bhlhe40 UTSW 6 108,642,169 (GRCm39) missense possibly damaging 0.55
R5913:Bhlhe40 UTSW 6 108,642,154 (GRCm39) missense possibly damaging 0.79
R6283:Bhlhe40 UTSW 6 108,641,992 (GRCm39) missense probably damaging 1.00
R6405:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6406:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6595:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6654:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6656:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6657:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6659:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6734:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6968:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7105:Bhlhe40 UTSW 6 108,641,997 (GRCm39) missense possibly damaging 0.96
R7323:Bhlhe40 UTSW 6 108,642,242 (GRCm39) missense probably benign 0.42
R7395:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7399:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7472:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7563:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7726:Bhlhe40 UTSW 6 108,639,559 (GRCm39) missense probably benign
R8058:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8319:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8320:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8380:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8381:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8428:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8431:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8432:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8988:Bhlhe40 UTSW 6 108,639,518 (GRCm39) missense probably damaging 1.00
R9381:Bhlhe40 UTSW 6 108,642,244 (GRCm39) missense probably damaging 1.00
R9582:Bhlhe40 UTSW 6 108,638,467 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AAAACCCTGTAACTAAGTGGTCGG -3'
(R):5'- TTTGGGAGCCGAGTCCAATG -3'

Sequencing Primer
(F):5'- CCCTGTAACTAAGTGGTCGGAATTTG -3'
(R):5'- AATGGTTTCCTGGAAGCACC -3'
Posted On 2018-03-15