Incidental Mutation 'R6281:Lilra6'
ID507957
Institutional Source Beutler Lab
Gene Symbol Lilra6
Ensembl Gene ENSMUSG00000030427
Gene Nameleukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6
SynonymsPira3, 7M1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R6281 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location3908280-3915503 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3911973 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 474 (L474P)
Ref Sequence ENSEMBL: ENSMUSP00000088188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038176] [ENSMUST00000090689] [ENSMUST00000206077]
Predicted Effect probably damaging
Transcript: ENSMUST00000038176
AA Change: L512P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000042636
Gene: ENSMUSG00000030427
AA Change: L512P

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
IG_like 40 105 3.11e0 SMART
IG 129 315 4.53e-2 SMART
IG_like 237 302 1.54e-1 SMART
IG_like 328 415 1.79e1 SMART
IG_like 429 517 2.66e1 SMART
IG 529 618 8.59e-3 SMART
low complexity region 637 646 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090689
AA Change: L474P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088188
Gene: ENSMUSG00000030427
AA Change: L474P

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
IG_like 34 118 7.25e0 SMART
IG_like 129 220 1.62e2 SMART
IG_like 290 377 1.79e1 SMART
IG_like 391 479 2.66e1 SMART
IG 491 580 8.59e-3 SMART
low complexity region 599 608 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131255
Predicted Effect probably benign
Transcript: ENSMUST00000206077
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206851
Meta Mutation Damage Score 0.43 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik C A 8: 121,531,881 C166F probably damaging Het
Aida C T 1: 183,322,290 A237V probably damaging Het
Ankib1 T C 5: 3,701,965 T692A possibly damaging Het
As3mt T C 19: 46,724,923 V303A possibly damaging Het
Bhlhe40 T A 6: 108,664,462 probably null Het
Bhmt2 G A 13: 93,663,160 P256L probably damaging Het
Bpifb1 T C 2: 154,206,465 I140T probably damaging Het
Cat A T 2: 103,471,769 H194Q probably damaging Het
Cbfa2t3 C A 8: 122,633,409 R466L probably damaging Het
Fancm T C 12: 65,088,270 V279A probably damaging Het
Gabra2 T C 5: 71,034,762 T75A probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm3512 T A 14: 7,159,254 D7V possibly damaging Het
Gpr15 A G 16: 58,718,594 F44S probably damaging Het
Ighv1-72 C A 12: 115,758,403 C5F probably benign Het
Mboat2 T C 12: 24,957,679 V297A probably benign Het
Muc2 C G 7: 141,752,403 C276W probably damaging Het
Ncor1 T C 11: 62,373,545 S141G possibly damaging Het
Olfr1283 T C 2: 111,369,549 *306R probably null Het
Olfr508 T G 7: 108,630,402 S137A probably benign Het
Pax5 T G 4: 44,691,955 E97A probably benign Het
Pcdhga11 A T 18: 37,757,373 D478V probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phf21b G T 15: 84,854,745 D38E probably benign Het
Ptcd1 T C 5: 145,165,071 K146R probably benign Het
Rad23a A T 8: 84,838,110 M166K probably damaging Het
Rfc4 A T 16: 23,118,066 probably null Het
Slc17a3 T A 13: 23,856,799 I336N probably benign Het
Slc2a12 T A 10: 22,665,320 M358K probably damaging Het
Stk31 T G 6: 49,469,180 M939R possibly damaging Het
Tecrl T A 5: 83,294,606 T167S probably damaging Het
Tfap2d G C 1: 19,104,478 G52R probably benign Het
Ttn C T 2: 76,941,828 V2577M probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vezt G A 10: 93,973,946 R578C probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vwa3b T A 1: 37,123,982 L562Q probably damaging Het
Zfyve27 T A 19: 42,182,755 N127K probably damaging Het
Znfx1 A G 2: 167,055,885 F373S probably damaging Het
Zswim8 G A 14: 20,714,640 V693I probably benign Het
Other mutations in Lilra6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Lilra6 APN 7 3911554 missense probably benign 0.04
IGL00569:Lilra6 APN 7 3914589 missense probably damaging 0.99
IGL00899:Lilra6 APN 7 3913057 missense probably damaging 1.00
IGL00955:Lilra6 APN 7 3911404 splice site probably benign
IGL01585:Lilra6 APN 7 3914499 missense probably benign 0.01
IGL02195:Lilra6 APN 7 3914550 missense probably benign 0.00
IGL02586:Lilra6 APN 7 3908820 missense probably benign 0.36
IGL02719:Lilra6 APN 7 3912992 missense possibly damaging 0.96
IGL03166:Lilra6 APN 7 3912627 missense possibly damaging 0.69
IGL03329:Lilra6 APN 7 3914648 splice site probably benign
R0233:Lilra6 UTSW 7 3914936 missense possibly damaging 0.69
R0233:Lilra6 UTSW 7 3914936 missense possibly damaging 0.69
R0423:Lilra6 UTSW 7 3914775 splice site probably benign
R0483:Lilra6 UTSW 7 3913139 missense probably benign 0.02
R0511:Lilra6 UTSW 7 3912785 missense possibly damaging 0.77
R1472:Lilra6 UTSW 7 3912719 missense probably damaging 1.00
R1560:Lilra6 UTSW 7 3911408 critical splice donor site probably null
R1584:Lilra6 UTSW 7 3912662 missense probably damaging 1.00
R1781:Lilra6 UTSW 7 3915067 missense probably benign 0.28
R2411:Lilra6 UTSW 7 3911454 missense probably damaging 1.00
R2420:Lilra6 UTSW 7 3914858 missense probably damaging 1.00
R4021:Lilra6 UTSW 7 3911418 missense probably benign 0.20
R4074:Lilra6 UTSW 7 3914890 missense probably benign 0.23
R4284:Lilra6 UTSW 7 3908804 missense possibly damaging 0.76
R4508:Lilra6 UTSW 7 3912029 nonsense probably null
R4894:Lilra6 UTSW 7 3912531 missense probably benign 0.01
R4977:Lilra6 UTSW 7 3914383 missense probably benign 0.01
R5048:Lilra6 UTSW 7 3915441 critical splice donor site probably null
R5164:Lilra6 UTSW 7 3914881 missense probably damaging 1.00
R5185:Lilra6 UTSW 7 3914636 missense probably benign 0.00
R5527:Lilra6 UTSW 7 3914587 start gained probably benign
R6480:Lilra6 UTSW 7 3912933 missense probably damaging 1.00
R6512:Lilra6 UTSW 7 3914388 missense probably benign 0.06
R6565:Lilra6 UTSW 7 3915020 missense probably benign
R7017:Lilra6 UTSW 7 3908708 missense possibly damaging 0.93
R7095:Lilra6 UTSW 7 3913197 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAGCTGGAATCACACATGAC -3'
(R):5'- ATTTGCTCTGCACAAGGTGGG -3'

Sequencing Primer
(F):5'- AGAACCTGGGCCTCTGTCTC -3'
(R):5'- GGGGAGCTGACATCATGC -3'
Posted On2018-03-15