Incidental Mutation 'R6281:1700018B08Rik'
ID507961
Institutional Source Beutler Lab
Gene Symbol 1700018B08Rik
Ensembl Gene ENSMUSG00000031809
Gene NameRIKEN cDNA 1700018B08 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6281 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location121530780-121544320 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 121531881 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 166 (C166F)
Ref Sequence ENSEMBL: ENSMUSP00000138106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034265] [ENSMUST00000127664] [ENSMUST00000182460] [ENSMUST00000182739] [ENSMUST00000183280]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034265
AA Change: C147F

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034265
Gene: ENSMUSG00000031809
AA Change: C147F

DomainStartEndE-ValueType
Pfam:DUF4568 3 213 1.4e-118 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182460
AA Change: C166F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138106
Gene: ENSMUSG00000031809
AA Change: C166F

DomainStartEndE-ValueType
Pfam:DUF4568 23 188 7.2e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182739
Predicted Effect probably benign
Transcript: ENSMUST00000183280
SMART Domains Protein: ENSMUSP00000138141
Gene: ENSMUSG00000031809

DomainStartEndE-ValueType
Pfam:DUF4568 3 48 2.1e-6 PFAM
Meta Mutation Damage Score 0.048 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aida C T 1: 183,322,290 A237V probably damaging Het
Ankib1 T C 5: 3,701,965 T692A possibly damaging Het
As3mt T C 19: 46,724,923 V303A possibly damaging Het
Bhlhe40 T A 6: 108,664,462 probably null Het
Bhmt2 G A 13: 93,663,160 P256L probably damaging Het
Bpifb1 T C 2: 154,206,465 I140T probably damaging Het
Cat A T 2: 103,471,769 H194Q probably damaging Het
Cbfa2t3 C A 8: 122,633,409 R466L probably damaging Het
Fancm T C 12: 65,088,270 V279A probably damaging Het
Gabra2 T C 5: 71,034,762 T75A probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm3512 T A 14: 7,159,254 D7V possibly damaging Het
Gpr15 A G 16: 58,718,594 F44S probably damaging Het
Ighv1-72 C A 12: 115,758,403 C5F probably benign Het
Lilra6 A G 7: 3,911,973 L474P probably damaging Het
Mboat2 T C 12: 24,957,679 V297A probably benign Het
Muc2 C G 7: 141,752,403 C276W probably damaging Het
Ncor1 T C 11: 62,373,545 S141G possibly damaging Het
Olfr1283 T C 2: 111,369,549 *306R probably null Het
Olfr508 T G 7: 108,630,402 S137A probably benign Het
Pax5 T G 4: 44,691,955 E97A probably benign Het
Pcdhga11 A T 18: 37,757,373 D478V probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phf21b G T 15: 84,854,745 D38E probably benign Het
Ptcd1 T C 5: 145,165,071 K146R probably benign Het
Rad23a A T 8: 84,838,110 M166K probably damaging Het
Rfc4 A T 16: 23,118,066 probably null Het
Slc17a3 T A 13: 23,856,799 I336N probably benign Het
Slc2a12 T A 10: 22,665,320 M358K probably damaging Het
Stk31 T G 6: 49,469,180 M939R possibly damaging Het
Tecrl T A 5: 83,294,606 T167S probably damaging Het
Tfap2d G C 1: 19,104,478 G52R probably benign Het
Ttn C T 2: 76,941,828 V2577M probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vezt G A 10: 93,973,946 R578C probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vwa3b T A 1: 37,123,982 L562Q probably damaging Het
Zfyve27 T A 19: 42,182,755 N127K probably damaging Het
Znfx1 A G 2: 167,055,885 F373S probably damaging Het
Zswim8 G A 14: 20,714,640 V693I probably benign Het
Other mutations in 1700018B08Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02700:1700018B08Rik APN 8 121535422 critical splice donor site probably null
IGL03124:1700018B08Rik APN 8 121541710 splice site probably benign
R1475:1700018B08Rik UTSW 8 121540588 splice site probably benign
R2883:1700018B08Rik UTSW 8 121539905 missense probably damaging 1.00
R3967:1700018B08Rik UTSW 8 121539980 missense possibly damaging 0.52
R6490:1700018B08Rik UTSW 8 121540554 missense probably benign 0.06
R6920:1700018B08Rik UTSW 8 121535421 critical splice donor site probably null
R6934:1700018B08Rik UTSW 8 121539973 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CACCAAATGGCTATGATGGC -3'
(R):5'- AGACACTGTCTGATGATGGTTG -3'

Sequencing Primer
(F):5'- TATGATGGCCCTCAGGACTG -3'
(R):5'- AGATCTGTGTTCGAGACCAGC -3'
Posted On2018-03-15