Incidental Mutation 'R6281:Gm11595'
ID507966
Institutional Source Beutler Lab
Gene Symbol Gm11595
Ensembl Gene ENSMUSG00000078668
Gene Namepredicted gene 11595
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R6281 (G1)
Quality Score164.009
Status Validated
Chromosome11
Chromosomal Location99771714-99772913 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 99772555 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 100 (R100C)
Ref Sequence ENSEMBL: ENSMUSP00000103064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107440]
Predicted Effect unknown
Transcript: ENSMUST00000107440
AA Change: R100C
SMART Domains Protein: ENSMUSP00000103064
Gene: ENSMUSG00000078668
AA Change: R100C

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 1 47 7.5e-9 PFAM
Pfam:Keratin_B2_2 14 58 2.8e-13 PFAM
Pfam:Keratin_B2_2 29 73 1.2e-13 PFAM
Pfam:Keratin_B2_2 72 112 2.3e-12 PFAM
Pfam:Keratin_B2_2 107 152 4.6e-14 PFAM
Pfam:Keratin_B2_2 118 162 1.1e-13 PFAM
Pfam:Keratin_B2_2 143 187 3.5e-10 PFAM
Pfam:Keratin_B2_2 168 212 5.6e-13 PFAM
Pfam:Keratin_B2_2 178 222 2.4e-12 PFAM
Pfam:Keratin_B2_2 208 257 1.6e-11 PFAM
Pfam:Keratin_B2_2 223 267 4e-14 PFAM
Pfam:Keratin_B2_2 248 289 9e-9 PFAM
Meta Mutation Damage Score 0.0696 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik C A 8: 121,531,881 C166F probably damaging Het
Aida C T 1: 183,322,290 A237V probably damaging Het
Ankib1 T C 5: 3,701,965 T692A possibly damaging Het
As3mt T C 19: 46,724,923 V303A possibly damaging Het
Bhlhe40 T A 6: 108,664,462 probably null Het
Bhmt2 G A 13: 93,663,160 P256L probably damaging Het
Bpifb1 T C 2: 154,206,465 I140T probably damaging Het
Cat A T 2: 103,471,769 H194Q probably damaging Het
Cbfa2t3 C A 8: 122,633,409 R466L probably damaging Het
Fancm T C 12: 65,088,270 V279A probably damaging Het
Gabra2 T C 5: 71,034,762 T75A probably damaging Het
Gm3512 T A 14: 7,159,254 D7V possibly damaging Het
Gpr15 A G 16: 58,718,594 F44S probably damaging Het
Ighv1-72 C A 12: 115,758,403 C5F probably benign Het
Lilra6 A G 7: 3,911,973 L474P probably damaging Het
Mboat2 T C 12: 24,957,679 V297A probably benign Het
Muc2 C G 7: 141,752,403 C276W probably damaging Het
Ncor1 T C 11: 62,373,545 S141G possibly damaging Het
Olfr1283 T C 2: 111,369,549 *306R probably null Het
Olfr508 T G 7: 108,630,402 S137A probably benign Het
Pax5 T G 4: 44,691,955 E97A probably benign Het
Pcdhga11 A T 18: 37,757,373 D478V probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phf21b G T 15: 84,854,745 D38E probably benign Het
Ptcd1 T C 5: 145,165,071 K146R probably benign Het
Rad23a A T 8: 84,838,110 M166K probably damaging Het
Rfc4 A T 16: 23,118,066 probably null Het
Slc17a3 T A 13: 23,856,799 I336N probably benign Het
Slc2a12 T A 10: 22,665,320 M358K probably damaging Het
Stk31 T G 6: 49,469,180 M939R possibly damaging Het
Tecrl T A 5: 83,294,606 T167S probably damaging Het
Tfap2d G C 1: 19,104,478 G52R probably benign Het
Ttn C T 2: 76,941,828 V2577M probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vezt G A 10: 93,973,946 R578C probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vwa3b T A 1: 37,123,982 L562Q probably damaging Het
Zfyve27 T A 19: 42,182,755 N127K probably damaging Het
Znfx1 A G 2: 167,055,885 F373S probably damaging Het
Zswim8 G A 14: 20,714,640 V693I probably benign Het
Other mutations in Gm11595
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Gm11595 APN 11 99772042 missense unknown
IGL00987:Gm11595 APN 11 99772539 missense unknown
IGL01662:Gm11595 APN 11 99772672 missense unknown
IGL01994:Gm11595 APN 11 99772201 missense unknown
R0548:Gm11595 UTSW 11 99772141 missense unknown
R1923:Gm11595 UTSW 11 99772539 missense unknown
R2127:Gm11595 UTSW 11 99772501 missense unknown
R2128:Gm11595 UTSW 11 99772501 missense unknown
R3807:Gm11595 UTSW 11 99772554 missense unknown
R4007:Gm11595 UTSW 11 99772035 missense unknown
R5281:Gm11595 UTSW 11 99772555 missense unknown
R5283:Gm11595 UTSW 11 99772555 missense unknown
R5303:Gm11595 UTSW 11 99772555 missense unknown
R5305:Gm11595 UTSW 11 99772555 missense unknown
R5306:Gm11595 UTSW 11 99772555 missense unknown
R5307:Gm11595 UTSW 11 99772555 missense unknown
R5308:Gm11595 UTSW 11 99772555 missense unknown
R5561:Gm11595 UTSW 11 99772555 missense unknown
R5637:Gm11595 UTSW 11 99772555 missense unknown
R5639:Gm11595 UTSW 11 99772555 missense unknown
R5718:Gm11595 UTSW 11 99772555 missense unknown
R5719:Gm11595 UTSW 11 99772555 missense unknown
R5720:Gm11595 UTSW 11 99772555 missense unknown
R5721:Gm11595 UTSW 11 99772555 missense unknown
R5769:Gm11595 UTSW 11 99772555 missense unknown
R5770:Gm11595 UTSW 11 99772555 missense unknown
R5771:Gm11595 UTSW 11 99772555 missense unknown
R5791:Gm11595 UTSW 11 99772555 missense unknown
R5841:Gm11595 UTSW 11 99772317 missense unknown
R6054:Gm11595 UTSW 11 99772648 missense unknown
R6277:Gm11595 UTSW 11 99772684 missense unknown
R6282:Gm11595 UTSW 11 99772555 missense unknown
R6310:Gm11595 UTSW 11 99772555 missense unknown
R6321:Gm11595 UTSW 11 99772555 missense unknown
R6322:Gm11595 UTSW 11 99772555 missense unknown
R6327:Gm11595 UTSW 11 99772555 missense unknown
R6337:Gm11595 UTSW 11 99772555 missense unknown
R6368:Gm11595 UTSW 11 99772555 missense unknown
R6369:Gm11595 UTSW 11 99772555 missense unknown
R6431:Gm11595 UTSW 11 99772774 missense unknown
R6483:Gm11595 UTSW 11 99772555 missense unknown
R6485:Gm11595 UTSW 11 99772555 missense unknown
R6493:Gm11595 UTSW 11 99772555 missense unknown
R6758:Gm11595 UTSW 11 99772540 missense unknown
R6758:Gm11595 UTSW 11 99772541 nonsense probably null
R7037:Gm11595 UTSW 11 99772648 missense unknown
Predicted Primers PCR Primer
(F):5'- TAGAACTACCACAGCAGGGG -3'
(R):5'- ACCATGGTCAGTTCCTGTTGTG -3'

Sequencing Primer
(F):5'- CGACAGCAGCTGGAGATG -3'
(R):5'- TGCCAGACCACCTGCTGTAG -3'
Posted On2018-03-15