Incidental Mutation 'R6281:Mboat2'
ID507967
Institutional Source Beutler Lab
Gene Symbol Mboat2
Ensembl Gene ENSMUSG00000020646
Gene Namemembrane bound O-acyltransferase domain containing 2
SynonymsOact2, 2810049G06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6281 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location24830879-24964397 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24957679 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 297 (V297A)
Ref Sequence ENSEMBL: ENSMUSP00000077937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078902] [ENSMUST00000110942] [ENSMUST00000221952] [ENSMUST00000222994]
Predicted Effect probably benign
Transcript: ENSMUST00000078902
AA Change: V297A

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000077937
Gene: ENSMUSG00000020646
AA Change: V297A

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 54 76 N/A INTRINSIC
Pfam:MBOAT 97 405 8.9e-35 PFAM
transmembrane domain 410 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110942
AA Change: V430A

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000106567
Gene: ENSMUSG00000020646
AA Change: V430A

DomainStartEndE-ValueType
Pfam:MBOAT 21 430 2.8e-32 PFAM
transmembrane domain 442 464 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221952
AA Change: V398A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000222994
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik C A 8: 121,531,881 C166F probably damaging Het
Aida C T 1: 183,322,290 A237V probably damaging Het
Ankib1 T C 5: 3,701,965 T692A possibly damaging Het
As3mt T C 19: 46,724,923 V303A possibly damaging Het
Bhlhe40 T A 6: 108,664,462 probably null Het
Bhmt2 G A 13: 93,663,160 P256L probably damaging Het
Bpifb1 T C 2: 154,206,465 I140T probably damaging Het
Cat A T 2: 103,471,769 H194Q probably damaging Het
Cbfa2t3 C A 8: 122,633,409 R466L probably damaging Het
Fancm T C 12: 65,088,270 V279A probably damaging Het
Gabra2 T C 5: 71,034,762 T75A probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm3512 T A 14: 7,159,254 D7V possibly damaging Het
Gpr15 A G 16: 58,718,594 F44S probably damaging Het
Ighv1-72 C A 12: 115,758,403 C5F probably benign Het
Lilra6 A G 7: 3,911,973 L474P probably damaging Het
Muc2 C G 7: 141,752,403 C276W probably damaging Het
Ncor1 T C 11: 62,373,545 S141G possibly damaging Het
Olfr1283 T C 2: 111,369,549 *306R probably null Het
Olfr508 T G 7: 108,630,402 S137A probably benign Het
Pax5 T G 4: 44,691,955 E97A probably benign Het
Pcdhga11 A T 18: 37,757,373 D478V probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phf21b G T 15: 84,854,745 D38E probably benign Het
Ptcd1 T C 5: 145,165,071 K146R probably benign Het
Rad23a A T 8: 84,838,110 M166K probably damaging Het
Rfc4 A T 16: 23,118,066 probably null Het
Slc17a3 T A 13: 23,856,799 I336N probably benign Het
Slc2a12 T A 10: 22,665,320 M358K probably damaging Het
Stk31 T G 6: 49,469,180 M939R possibly damaging Het
Tecrl T A 5: 83,294,606 T167S probably damaging Het
Tfap2d G C 1: 19,104,478 G52R probably benign Het
Ttn C T 2: 76,941,828 V2577M probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vezt G A 10: 93,973,946 R578C probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vwa3b T A 1: 37,123,982 L562Q probably damaging Het
Zfyve27 T A 19: 42,182,755 N127K probably damaging Het
Znfx1 A G 2: 167,055,885 F373S probably damaging Het
Zswim8 G A 14: 20,714,640 V693I probably benign Het
Other mutations in Mboat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Mboat2 APN 12 24939354 splice site probably benign
IGL00755:Mboat2 APN 12 24957646 missense probably benign 0.20
IGL01691:Mboat2 APN 12 24954222 missense probably damaging 1.00
IGL02824:Mboat2 APN 12 24946586 missense probably benign 0.03
R1052:Mboat2 UTSW 12 24946528 missense probably damaging 1.00
R1531:Mboat2 UTSW 12 24959030 missense probably benign
R1998:Mboat2 UTSW 12 24946673 missense possibly damaging 0.58
R1999:Mboat2 UTSW 12 24946673 missense possibly damaging 0.58
R2069:Mboat2 UTSW 12 24951443 missense probably benign
R2921:Mboat2 UTSW 12 24954240 missense probably damaging 1.00
R2923:Mboat2 UTSW 12 24954240 missense probably damaging 1.00
R3113:Mboat2 UTSW 12 24882719 missense probably damaging 1.00
R4300:Mboat2 UTSW 12 24959083 missense probably benign 0.33
R5133:Mboat2 UTSW 12 24959066 missense probably benign 0.00
R5356:Mboat2 UTSW 12 24957573 missense probably benign 0.24
R6084:Mboat2 UTSW 12 24878285 missense probably damaging 1.00
R6184:Mboat2 UTSW 12 24951431 missense possibly damaging 0.54
R6194:Mboat2 UTSW 12 24946638 missense probably benign 0.07
R7026:Mboat2 UTSW 12 24948382 critical splice donor site probably null
R7269:Mboat2 UTSW 12 24831709 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGTGAGAGTGTTACTCCGCAG -3'
(R):5'- GAAGTAACTGCTAGTATACGGCAC -3'

Sequencing Primer
(F):5'- CAGGCTTGAAGTTGCTGTCC -3'
(R):5'- CACGGCAGAGTGAGGCTG -3'
Posted On2018-03-15