Incidental Mutation 'R6281:Fancm'
ID507968
Institutional Source Beutler Lab
Gene Symbol Fancm
Ensembl Gene ENSMUSG00000055884
Gene NameFanconi anemia, complementation group M
SynonymsD12Ertd364e, C730036B14Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_178912.3; MGI:2442306

Is this an essential gene? Probably essential (E-score: 0.910) question?
Stock #R6281 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location65075603-65132058 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65088270 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 279 (V279A)
Ref Sequence ENSEMBL: ENSMUSP00000152854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058889] [ENSMUST00000222540]
Predicted Effect probably damaging
Transcript: ENSMUST00000058889
AA Change: V279A

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000054797
Gene: ENSMUSG00000055884
AA Change: V279A

DomainStartEndE-ValueType
DEXDc 75 275 5.6e-25 SMART
Blast:DEXDc 295 323 9e-6 BLAST
low complexity region 339 348 N/A INTRINSIC
HELICc 475 566 5.64e-21 SMART
Pfam:FANCM-MHF_bd 657 770 8.5e-50 PFAM
low complexity region 850 866 N/A INTRINSIC
low complexity region 974 987 N/A INTRINSIC
low complexity region 1105 1120 N/A INTRINSIC
low complexity region 1165 1178 N/A INTRINSIC
PDB:4DAY|C 1207 1238 1e-6 PDB
low complexity region 1489 1506 N/A INTRINSIC
low complexity region 1572 1586 N/A INTRINSIC
low complexity region 1669 1682 N/A INTRINSIC
ERCC4 1780 1863 2.07e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000222540
AA Change: V279A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223051
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223401
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (40/40)
MGI Phenotype Strain: 4355560
Lethality: D500-D600
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group M. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced female transmission, hypogonadism, premature death, and increased incidence of tumors. [provided by MGI curators]
Allele List at MGI

All alleles(39) : Targeted(4) Gene trapped(35)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik C A 8: 121,531,881 C166F probably damaging Het
Aida C T 1: 183,322,290 A237V probably damaging Het
Ankib1 T C 5: 3,701,965 T692A possibly damaging Het
As3mt T C 19: 46,724,923 V303A possibly damaging Het
Bhlhe40 T A 6: 108,664,462 probably null Het
Bhmt2 G A 13: 93,663,160 P256L probably damaging Het
Bpifb1 T C 2: 154,206,465 I140T probably damaging Het
Cat A T 2: 103,471,769 H194Q probably damaging Het
Cbfa2t3 C A 8: 122,633,409 R466L probably damaging Het
Gabra2 T C 5: 71,034,762 T75A probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm3512 T A 14: 7,159,254 D7V possibly damaging Het
Gpr15 A G 16: 58,718,594 F44S probably damaging Het
Ighv1-72 C A 12: 115,758,403 C5F probably benign Het
Lilra6 A G 7: 3,911,973 L474P probably damaging Het
Mboat2 T C 12: 24,957,679 V297A probably benign Het
Muc2 C G 7: 141,752,403 C276W probably damaging Het
Ncor1 T C 11: 62,373,545 S141G possibly damaging Het
Olfr1283 T C 2: 111,369,549 *306R probably null Het
Olfr508 T G 7: 108,630,402 S137A probably benign Het
Pax5 T G 4: 44,691,955 E97A probably benign Het
Pcdhga11 A T 18: 37,757,373 D478V probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phf21b G T 15: 84,854,745 D38E probably benign Het
Ptcd1 T C 5: 145,165,071 K146R probably benign Het
Rad23a A T 8: 84,838,110 M166K probably damaging Het
Rfc4 A T 16: 23,118,066 probably null Het
Slc17a3 T A 13: 23,856,799 I336N probably benign Het
Slc2a12 T A 10: 22,665,320 M358K probably damaging Het
Stk31 T G 6: 49,469,180 M939R possibly damaging Het
Tecrl T A 5: 83,294,606 T167S probably damaging Het
Tfap2d G C 1: 19,104,478 G52R probably benign Het
Ttn C T 2: 76,941,828 V2577M probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vezt G A 10: 93,973,946 R578C probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vwa3b T A 1: 37,123,982 L562Q probably damaging Het
Zfyve27 T A 19: 42,182,755 N127K probably damaging Het
Znfx1 A G 2: 167,055,885 F373S probably damaging Het
Zswim8 G A 14: 20,714,640 V693I probably benign Het
Other mutations in Fancm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Fancm APN 12 65075736 missense possibly damaging 0.50
IGL00489:Fancm APN 12 65106193 missense probably benign 0.01
IGL00529:Fancm APN 12 65130417 utr 3 prime probably benign
IGL00898:Fancm APN 12 65106000 missense probably benign 0.01
IGL01805:Fancm APN 12 65113861 critical splice donor site probably null
IGL01986:Fancm APN 12 65126655 nonsense probably null
IGL02026:Fancm APN 12 65105734 missense probably benign 0.03
IGL02069:Fancm APN 12 65075911 missense probably benign 0.05
IGL02103:Fancm APN 12 65095784 missense probably benign 0.38
IGL02133:Fancm APN 12 65106475 missense probably benign 0.04
IGL02400:Fancm APN 12 65113815 missense probably damaging 1.00
IGL02478:Fancm APN 12 65077090 missense probably damaging 1.00
IGL02479:Fancm APN 12 65106485 missense probably damaging 0.98
IGL02563:Fancm APN 12 65092462 missense probably damaging 1.00
IGL02606:Fancm APN 12 65076139 missense possibly damaging 0.90
IGL02731:Fancm APN 12 65088305 missense probably benign 0.00
IGL02809:Fancm APN 12 65121667 missense possibly damaging 0.54
IGL02953:Fancm APN 12 65121966 missense probably benign 0.27
IGL03066:Fancm APN 12 65125114 nonsense probably null
IGL03073:Fancm APN 12 65101632 missense probably damaging 1.00
PIT4131001:Fancm UTSW 12 65105422 missense probably benign 0.03
R0041:Fancm UTSW 12 65106443 nonsense probably null
R0041:Fancm UTSW 12 65106443 nonsense probably null
R0125:Fancm UTSW 12 65121956 missense possibly damaging 0.68
R0201:Fancm UTSW 12 65101632 missense probably damaging 1.00
R0360:Fancm UTSW 12 65075950 missense probably damaging 1.00
R0491:Fancm UTSW 12 65106061 missense probably benign 0.32
R0557:Fancm UTSW 12 65118442 critical splice donor site probably null
R0617:Fancm UTSW 12 65097317 nonsense probably null
R1201:Fancm UTSW 12 65106768 missense possibly damaging 0.66
R1353:Fancm UTSW 12 65088170 missense probably damaging 1.00
R1456:Fancm UTSW 12 65118351 missense possibly damaging 0.48
R1468:Fancm UTSW 12 65099293 missense probably damaging 1.00
R1468:Fancm UTSW 12 65099293 missense probably damaging 1.00
R1521:Fancm UTSW 12 65121704 missense probably benign 0.25
R1530:Fancm UTSW 12 65092490 critical splice donor site probably null
R1559:Fancm UTSW 12 65093689 missense probably benign 0.00
R1632:Fancm UTSW 12 65130331 missense probably damaging 1.00
R1681:Fancm UTSW 12 65105656 missense probably benign 0.03
R1919:Fancm UTSW 12 65105520 missense possibly damaging 0.48
R1969:Fancm UTSW 12 65101692 missense probably benign 0.09
R1971:Fancm UTSW 12 65101692 missense probably benign 0.09
R2117:Fancm UTSW 12 65077174 missense probably damaging 1.00
R2510:Fancm UTSW 12 65113770 splice site probably benign
R2909:Fancm UTSW 12 65124856 missense probably damaging 1.00
R3155:Fancm UTSW 12 65116421 missense probably benign 0.32
R3405:Fancm UTSW 12 65075772 missense probably benign 0.00
R4133:Fancm UTSW 12 65120530 missense probably benign 0.44
R4308:Fancm UTSW 12 65126531 missense probably benign 0.14
R4588:Fancm UTSW 12 65118441 critical splice donor site probably null
R4602:Fancm UTSW 12 65124944 missense probably benign 0.12
R4653:Fancm UTSW 12 65083054 missense probably damaging 0.99
R4702:Fancm UTSW 12 65122052 missense possibly damaging 0.95
R4719:Fancm UTSW 12 65121706 missense possibly damaging 0.64
R4885:Fancm UTSW 12 65102643 nonsense probably null
R4896:Fancm UTSW 12 65075831 missense probably damaging 1.00
R4908:Fancm UTSW 12 65094871 missense probably benign 0.28
R4921:Fancm UTSW 12 65077141 missense probably benign 0.19
R4922:Fancm UTSW 12 65106892 critical splice donor site probably null
R4948:Fancm UTSW 12 65090974 missense probably damaging 1.00
R5103:Fancm UTSW 12 65105858 missense probably damaging 0.99
R5577:Fancm UTSW 12 65130411 utr 3 prime probably benign
R5631:Fancm UTSW 12 65113843 missense probably damaging 0.97
R5741:Fancm UTSW 12 65101615 missense probably benign 0.01
R6137:Fancm UTSW 12 65130382 missense probably damaging 1.00
R6167:Fancm UTSW 12 65094895 missense probably benign 0.42
R6242:Fancm UTSW 12 65116442 missense probably benign 0.01
R6242:Fancm UTSW 12 65116449 missense probably benign 0.00
R6325:Fancm UTSW 12 65125052 missense probably damaging 1.00
R6434:Fancm UTSW 12 65077168 missense probably damaging 1.00
R6493:Fancm UTSW 12 65097488 missense probably benign 0.04
R6542:Fancm UTSW 12 65097429 missense probably damaging 1.00
R6645:Fancm UTSW 12 65106100 missense probably damaging 0.99
R6878:Fancm UTSW 12 65116423 nonsense probably null
R7171:Fancm UTSW 12 65101620 missense probably damaging 0.99
R7172:Fancm UTSW 12 65106054 missense possibly damaging 0.95
R7498:Fancm UTSW 12 65099391 missense not run
Predicted Primers PCR Primer
(F):5'- ACACAGTAGAGCTGAGTCCC -3'
(R):5'- TGAAAATAGGGCTGGCTGAC -3'

Sequencing Primer
(F):5'- CAGGGTCTTGTCATATAGCCCAG -3'
(R):5'- CCCCCAAAGTTTCAATTTCAGAGATG -3'
Posted On2018-03-15