Incidental Mutation 'R6281:Bhmt2'
ID507971
Institutional Source Beutler Lab
Gene Symbol Bhmt2
Ensembl Gene ENSMUSG00000042118
Gene Namebetaine-homocysteine methyltransferase 2
SynonymsC81077, D13Ucla2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R6281 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location93655720-93674302 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 93663160 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 256 (P256L)
Ref Sequence ENSEMBL: ENSMUSP00000015941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015941]
Predicted Effect probably damaging
Transcript: ENSMUST00000015941
AA Change: P256L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015941
Gene: ENSMUSG00000042118
AA Change: P256L

DomainStartEndE-ValueType
Pfam:S-methyl_trans 23 305 3.9e-44 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Homocysteine is a sulfur-containing amino acid that plays a crucial role in methylation reactions. Transfer of the methyl group from betaine to homocysteine creates methionine, which donates the methyl group to methylate DNA, proteins, lipids, and other intracellular metabolites. The protein encoded by this gene is one of two methyl transferases that can catalyze the transfer of the methyl group from betaine to homocysteine. Anomalies in homocysteine metabolism have been implicated in disorders ranging from vascular disease to neural tube birth defects such as spina bifida. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik C A 8: 121,531,881 C166F probably damaging Het
Aida C T 1: 183,322,290 A237V probably damaging Het
Ankib1 T C 5: 3,701,965 T692A possibly damaging Het
As3mt T C 19: 46,724,923 V303A possibly damaging Het
Bhlhe40 T A 6: 108,664,462 probably null Het
Bpifb1 T C 2: 154,206,465 I140T probably damaging Het
Cat A T 2: 103,471,769 H194Q probably damaging Het
Cbfa2t3 C A 8: 122,633,409 R466L probably damaging Het
Fancm T C 12: 65,088,270 V279A probably damaging Het
Gabra2 T C 5: 71,034,762 T75A probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm3512 T A 14: 7,159,254 D7V possibly damaging Het
Gpr15 A G 16: 58,718,594 F44S probably damaging Het
Ighv1-72 C A 12: 115,758,403 C5F probably benign Het
Lilra6 A G 7: 3,911,973 L474P probably damaging Het
Mboat2 T C 12: 24,957,679 V297A probably benign Het
Muc2 C G 7: 141,752,403 C276W probably damaging Het
Ncor1 T C 11: 62,373,545 S141G possibly damaging Het
Olfr1283 T C 2: 111,369,549 *306R probably null Het
Olfr508 T G 7: 108,630,402 S137A probably benign Het
Pax5 T G 4: 44,691,955 E97A probably benign Het
Pcdhga11 A T 18: 37,757,373 D478V probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phf21b G T 15: 84,854,745 D38E probably benign Het
Ptcd1 T C 5: 145,165,071 K146R probably benign Het
Rad23a A T 8: 84,838,110 M166K probably damaging Het
Rfc4 A T 16: 23,118,066 probably null Het
Slc17a3 T A 13: 23,856,799 I336N probably benign Het
Slc2a12 T A 10: 22,665,320 M358K probably damaging Het
Stk31 T G 6: 49,469,180 M939R possibly damaging Het
Tecrl T A 5: 83,294,606 T167S probably damaging Het
Tfap2d G C 1: 19,104,478 G52R probably benign Het
Ttn C T 2: 76,941,828 V2577M probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vezt G A 10: 93,973,946 R578C probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vwa3b T A 1: 37,123,982 L562Q probably damaging Het
Zfyve27 T A 19: 42,182,755 N127K probably damaging Het
Znfx1 A G 2: 167,055,885 F373S probably damaging Het
Zswim8 G A 14: 20,714,640 V693I probably benign Het
Other mutations in Bhmt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Bhmt2 APN 13 93666771 splice site probably benign
IGL01665:Bhmt2 APN 13 93663153 nonsense probably null
IGL02059:Bhmt2 APN 13 93666663 missense probably benign
IGL02239:Bhmt2 APN 13 93663179 missense probably benign 0.00
IGL02267:Bhmt2 APN 13 93669346 missense probably damaging 1.00
IGL03148:Bhmt2 APN 13 93666653 missense possibly damaging 0.48
R1171:Bhmt2 UTSW 13 93662329 missense probably benign 0.00
R1517:Bhmt2 UTSW 13 93662339 missense probably damaging 0.97
R1886:Bhmt2 UTSW 13 93662490 missense probably benign 0.02
R2167:Bhmt2 UTSW 13 93662504 missense probably benign 0.29
R4024:Bhmt2 UTSW 13 93663331 splice site probably benign
R4823:Bhmt2 UTSW 13 93663290 missense probably benign
R5273:Bhmt2 UTSW 13 93666578 missense possibly damaging 0.84
R5333:Bhmt2 UTSW 13 93671430 missense probably benign 0.00
R5738:Bhmt2 UTSW 13 93663290 missense probably benign
R5955:Bhmt2 UTSW 13 93663197 missense probably benign 0.00
R6858:Bhmt2 UTSW 13 93671440 missense probably damaging 0.97
R6934:Bhmt2 UTSW 13 93662311 missense probably benign 0.18
R6985:Bhmt2 UTSW 13 93663322 missense possibly damaging 0.64
R7185:Bhmt2 UTSW 13 93663271 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- AACAGCAGGTTCCTGACTGG -3'
(R):5'- TTAATTGCCTTGCACAGGGG -3'

Sequencing Primer
(F):5'- GACTGGTTGGGTTTTTCCTCCATC -3'
(R):5'- GCGGACATCATTGGGGTCAAC -3'
Posted On2018-03-15