Incidental Mutation 'R6281:Rfc4'
ID507975
Institutional Source Beutler Lab
Gene Symbol Rfc4
Ensembl Gene ENSMUSG00000022881
Gene Namereplication factor C (activator 1) 4
SynonymsA1, RFC37
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R6281 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location23113943-23127737 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 23118066 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023598] [ENSMUST00000023599] [ENSMUST00000077605] [ENSMUST00000115337] [ENSMUST00000115338] [ENSMUST00000115341] [ENSMUST00000123413] [ENSMUST00000131871] [ENSMUST00000133847] [ENSMUST00000147117] [ENSMUST00000168891] [ENSMUST00000187168]
Predicted Effect probably null
Transcript: ENSMUST00000023598
SMART Domains Protein: ENSMUSP00000023598
Gene: ENSMUSG00000022881

DomainStartEndE-ValueType
AAA 70 202 5.8e-13 SMART
Pfam:Rep_fac_C 267 356 2.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000023599
SMART Domains Protein: ENSMUSP00000023599
Gene: ENSMUSG00000022884

DomainStartEndE-ValueType
DEXDc 52 250 4.62e-58 SMART
HELICc 287 368 5.21e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077605
SMART Domains Protein: ENSMUSP00000090876
Gene: ENSMUSG00000022884

DomainStartEndE-ValueType
DEXDc 52 250 4.62e-58 SMART
HELICc 287 362 1.86e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115337
SMART Domains Protein: ENSMUSP00000110994
Gene: ENSMUSG00000022881

DomainStartEndE-ValueType
SCOP:d1iqpa2 29 67 2e-5 SMART
PDB:1SXJ|D 39 76 4e-8 PDB
Predicted Effect probably null
Transcript: ENSMUST00000115338
SMART Domains Protein: ENSMUSP00000110995
Gene: ENSMUSG00000022881

DomainStartEndE-ValueType
AAA 70 202 5.8e-13 SMART
Pfam:Rep_fac_C 269 344 3.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115341
SMART Domains Protein: ENSMUSP00000110998
Gene: ENSMUSG00000022884

DomainStartEndE-ValueType
DEXDc 53 251 4.62e-58 SMART
HELICc 288 369 5.21e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123413
SMART Domains Protein: ENSMUSP00000115649
Gene: ENSMUSG00000022884

DomainStartEndE-ValueType
DEXDc 52 250 4.62e-58 SMART
HELICc 287 362 1.86e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131871
SMART Domains Protein: ENSMUSP00000118141
Gene: ENSMUSG00000022884

DomainStartEndE-ValueType
PDB:3EIQ|D 4 70 2e-33 PDB
Blast:DEXDc 17 73 3e-25 BLAST
SCOP:d1qdea_ 25 71 2e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000133847
SMART Domains Protein: ENSMUSP00000115479
Gene: ENSMUSG00000022881

DomainStartEndE-ValueType
Pfam:Rad17 32 97 3.7e-9 PFAM
Pfam:AAA 74 98 2.4e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147117
SMART Domains Protein: ENSMUSP00000121745
Gene: ENSMUSG00000022884

DomainStartEndE-ValueType
PDB:3EIQ|D 4 69 4e-33 PDB
Blast:DEXDc 16 72 3e-25 BLAST
SCOP:d1qdea_ 24 70 2e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147321
Predicted Effect probably benign
Transcript: ENSMUST00000168891
SMART Domains Protein: ENSMUSP00000127030
Gene: ENSMUSG00000022884

DomainStartEndE-ValueType
DEXDc 1 155 1.92e-14 SMART
HELICc 192 273 5.21e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187168
SMART Domains Protein: ENSMUSP00000140809
Gene: ENSMUSG00000022884

DomainStartEndE-ValueType
DEXDc 52 250 4.62e-58 SMART
HELICc 287 362 1.86e-21 SMART
Meta Mutation Damage Score 0.5996 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The elongation of primed DNA templates by DNA polymerase delta and DNA polymerase epsilon requires the accessory proteins proliferating cell nuclear antigen (PCNA) and replication factor C (RFC). RFC, also named activator 1, is a protein complex consisting of five distinct subunits of 140, 40, 38, 37, and 36 kD. This gene encodes the 37 kD subunit. This subunit forms a core complex with the 36 and 40 kDa subunits. The core complex possesses DNA-dependent ATPase activity, which was found to be stimulated by PCNA in an in vitro system. Alternatively spliced transcript variants encoding the same protein have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik C A 8: 121,531,881 C166F probably damaging Het
Aida C T 1: 183,322,290 A237V probably damaging Het
Ankib1 T C 5: 3,701,965 T692A possibly damaging Het
As3mt T C 19: 46,724,923 V303A possibly damaging Het
Bhlhe40 T A 6: 108,664,462 probably null Het
Bhmt2 G A 13: 93,663,160 P256L probably damaging Het
Bpifb1 T C 2: 154,206,465 I140T probably damaging Het
Cat A T 2: 103,471,769 H194Q probably damaging Het
Cbfa2t3 C A 8: 122,633,409 R466L probably damaging Het
Fancm T C 12: 65,088,270 V279A probably damaging Het
Gabra2 T C 5: 71,034,762 T75A probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm3512 T A 14: 7,159,254 D7V possibly damaging Het
Gpr15 A G 16: 58,718,594 F44S probably damaging Het
Ighv1-72 C A 12: 115,758,403 C5F probably benign Het
Lilra6 A G 7: 3,911,973 L474P probably damaging Het
Mboat2 T C 12: 24,957,679 V297A probably benign Het
Muc2 C G 7: 141,752,403 C276W probably damaging Het
Ncor1 T C 11: 62,373,545 S141G possibly damaging Het
Olfr1283 T C 2: 111,369,549 *306R probably null Het
Olfr508 T G 7: 108,630,402 S137A probably benign Het
Pax5 T G 4: 44,691,955 E97A probably benign Het
Pcdhga11 A T 18: 37,757,373 D478V probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phf21b G T 15: 84,854,745 D38E probably benign Het
Ptcd1 T C 5: 145,165,071 K146R probably benign Het
Rad23a A T 8: 84,838,110 M166K probably damaging Het
Slc17a3 T A 13: 23,856,799 I336N probably benign Het
Slc2a12 T A 10: 22,665,320 M358K probably damaging Het
Stk31 T G 6: 49,469,180 M939R possibly damaging Het
Tecrl T A 5: 83,294,606 T167S probably damaging Het
Tfap2d G C 1: 19,104,478 G52R probably benign Het
Ttn C T 2: 76,941,828 V2577M probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vezt G A 10: 93,973,946 R578C probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vwa3b T A 1: 37,123,982 L562Q probably damaging Het
Zfyve27 T A 19: 42,182,755 N127K probably damaging Het
Znfx1 A G 2: 167,055,885 F373S probably damaging Het
Zswim8 G A 14: 20,714,640 V693I probably benign Het
Other mutations in Rfc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Rfc4 APN 16 23115776 missense probably damaging 1.00
IGL01625:Rfc4 APN 16 23115823 missense probably damaging 1.00
IGL02238:Rfc4 APN 16 23114469 missense probably damaging 0.99
IGL02693:Rfc4 APN 16 23114210 missense probably damaging 1.00
R6409_Rfc4_790 UTSW 16 23114073 makesense probably null
R0094:Rfc4 UTSW 16 23115428 missense probably benign 0.03
R0230:Rfc4 UTSW 16 23114099 nonsense probably null
R1493:Rfc4 UTSW 16 23118008 missense probably damaging 1.00
R1699:Rfc4 UTSW 16 23114233 missense probably benign 0.00
R2119:Rfc4 UTSW 16 23124564 missense probably damaging 1.00
R2194:Rfc4 UTSW 16 23114152 unclassified probably benign
R4575:Rfc4 UTSW 16 23114429 unclassified probably benign
R5097:Rfc4 UTSW 16 23114296 missense possibly damaging 0.82
R5495:Rfc4 UTSW 16 23122254 intron probably benign
R6118:Rfc4 UTSW 16 23120943 missense probably damaging 1.00
R6160:Rfc4 UTSW 16 23114683 missense probably damaging 1.00
R6232:Rfc4 UTSW 16 23114090 unclassified probably benign
R6310:Rfc4 UTSW 16 23114709 missense probably benign 0.37
R6409:Rfc4 UTSW 16 23114073 makesense probably null
R6411:Rfc4 UTSW 16 23114073 makesense probably null
R7161:Rfc4 UTSW 16 23115433 missense probably benign 0.03
R7202:Rfc4 UTSW 16 23127609 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TCCAATACTTGACAGAAGGCC -3'
(R):5'- GCAAGCTATTCTATGGGAAGAAGTC -3'

Sequencing Primer
(F):5'- TACTTGACAGAAGGCCAAATTAAAAC -3'
(R):5'- CTGGCTTTGAAGTCACAGAGATCC -3'
Posted On2018-03-15