Incidental Mutation 'R6281:Gpr15'
ID507976
Institutional Source Beutler Lab
Gene Symbol Gpr15
Ensembl Gene ENSMUSG00000047293
Gene NameG protein-coupled receptor 15
Synonyms4933439K08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6281 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location58717433-58719070 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58718594 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 44 (F44S)
Ref Sequence ENSEMBL: ENSMUSP00000086731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089318]
Predicted Effect probably damaging
Transcript: ENSMUST00000089318
AA Change: F44S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086731
Gene: ENSMUSG00000047293
AA Change: F44S

DomainStartEndE-ValueType
Pfam:7tm_1 50 302 1.3e-46 PFAM
Pfam:7TM_GPCR_Srv 66 317 7.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231342
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232532
Meta Mutation Damage Score 0.272 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G protein-coupled receptor that acts as a chemokine receptor for human immunodeficiency virus type 1 and 2. The encoded protein localizes to the cell membrane. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a a knock-out allele exhibit impaired regulatory T cell homing in the large intestine mucosa. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik C A 8: 121,531,881 C166F probably damaging Het
Aida C T 1: 183,322,290 A237V probably damaging Het
Ankib1 T C 5: 3,701,965 T692A possibly damaging Het
As3mt T C 19: 46,724,923 V303A possibly damaging Het
Bhlhe40 T A 6: 108,664,462 probably null Het
Bhmt2 G A 13: 93,663,160 P256L probably damaging Het
Bpifb1 T C 2: 154,206,465 I140T probably damaging Het
Cat A T 2: 103,471,769 H194Q probably damaging Het
Cbfa2t3 C A 8: 122,633,409 R466L probably damaging Het
Fancm T C 12: 65,088,270 V279A probably damaging Het
Gabra2 T C 5: 71,034,762 T75A probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm3512 T A 14: 7,159,254 D7V possibly damaging Het
Ighv1-72 C A 12: 115,758,403 C5F probably benign Het
Lilra6 A G 7: 3,911,973 L474P probably damaging Het
Mboat2 T C 12: 24,957,679 V297A probably benign Het
Muc2 C G 7: 141,752,403 C276W probably damaging Het
Ncor1 T C 11: 62,373,545 S141G possibly damaging Het
Olfr1283 T C 2: 111,369,549 *306R probably null Het
Olfr508 T G 7: 108,630,402 S137A probably benign Het
Pax5 T G 4: 44,691,955 E97A probably benign Het
Pcdhga11 A T 18: 37,757,373 D478V probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phf21b G T 15: 84,854,745 D38E probably benign Het
Ptcd1 T C 5: 145,165,071 K146R probably benign Het
Rad23a A T 8: 84,838,110 M166K probably damaging Het
Rfc4 A T 16: 23,118,066 probably null Het
Slc17a3 T A 13: 23,856,799 I336N probably benign Het
Slc2a12 T A 10: 22,665,320 M358K probably damaging Het
Stk31 T G 6: 49,469,180 M939R possibly damaging Het
Tecrl T A 5: 83,294,606 T167S probably damaging Het
Tfap2d G C 1: 19,104,478 G52R probably benign Het
Ttn C T 2: 76,941,828 V2577M probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vezt G A 10: 93,973,946 R578C probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vwa3b T A 1: 37,123,982 L562Q probably damaging Het
Zfyve27 T A 19: 42,182,755 N127K probably damaging Het
Znfx1 A G 2: 167,055,885 F373S probably damaging Het
Zswim8 G A 14: 20,714,640 V693I probably benign Het
Other mutations in Gpr15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Gpr15 APN 16 58718078 missense probably damaging 0.99
IGL02616:Gpr15 APN 16 58718204 missense probably damaging 1.00
IGL03381:Gpr15 APN 16 58717976 missense probably damaging 1.00
PIT4418001:Gpr15 UTSW 16 58717950 missense probably benign 0.13
R1484:Gpr15 UTSW 16 58718574 missense probably damaging 1.00
R1775:Gpr15 UTSW 16 58718558 missense probably benign 0.05
R1959:Gpr15 UTSW 16 58718007 missense probably benign 0.03
R1961:Gpr15 UTSW 16 58718007 missense probably benign 0.03
R2127:Gpr15 UTSW 16 58718255 missense possibly damaging 0.67
R3825:Gpr15 UTSW 16 58718360 missense probably damaging 1.00
R4957:Gpr15 UTSW 16 58718174 missense probably damaging 0.99
R5098:Gpr15 UTSW 16 58718527 missense probably damaging 1.00
R5180:Gpr15 UTSW 16 58717885 missense probably benign 0.07
R5668:Gpr15 UTSW 16 58717650 missense probably damaging 1.00
R6104:Gpr15 UTSW 16 58717976 missense probably damaging 1.00
R6921:Gpr15 UTSW 16 58717781 missense probably benign 0.00
R6980:Gpr15 UTSW 16 58718742 start gained probably benign
R6981:Gpr15 UTSW 16 58718185 missense probably benign 0.44
R7252:Gpr15 UTSW 16 58718397 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAAGAGCCAGTCCTCCATAG -3'
(R):5'- GGTGTACATCAAGACGCTCC -3'

Sequencing Primer
(F):5'- AGTCCTCCATAGTCCTAGAGAGG -3'
(R):5'- GTACATCAAGACGCTCCCTTGG -3'
Posted On2018-03-15