Incidental Mutation 'R6281:As3mt'
ID507980
Institutional Source Beutler Lab
Gene Symbol As3mt
Ensembl Gene ENSMUSG00000003559
Gene Namearsenic (+3 oxidation state) methyltransferase
Synonyms2310045H08Rik, Cyt19
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R6281 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location46707443-46741095 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46724923 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 303 (V303A)
Ref Sequence ENSEMBL: ENSMUSP00000003655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003655]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003655
AA Change: V303A

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000003655
Gene: ENSMUSG00000003559
AA Change: V303A

DomainStartEndE-ValueType
Pfam:Methyltransf_23 34 227 2.5e-14 PFAM
Pfam:PCMT 64 183 7.7e-9 PFAM
Pfam:Ubie_methyltran 64 196 8.9e-16 PFAM
Pfam:PrmA 65 193 1.8e-6 PFAM
Pfam:Methyltransf_31 70 243 2e-36 PFAM
Pfam:Methyltransf_18 71 187 9.7e-14 PFAM
Pfam:Methyltransf_25 75 180 2.8e-15 PFAM
Pfam:Methyltransf_12 76 182 2.9e-14 PFAM
Pfam:Methyltransf_11 76 184 2.7e-19 PFAM
low complexity region 297 310 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] AS3MT catalyzes the transfer of a methyl group from S-adenosyl-L-methionine (AdoMet) to trivalent arsenical and may play a role in arsenic metabolism (Lin et al., 2002 [PubMed 11790780]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele have abnormalities in arsenic methylation and in the distribution/retention of orally administered arsenate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik C A 8: 121,531,881 C166F probably damaging Het
Aida C T 1: 183,322,290 A237V probably damaging Het
Ankib1 T C 5: 3,701,965 T692A possibly damaging Het
Bhlhe40 T A 6: 108,664,462 probably null Het
Bhmt2 G A 13: 93,663,160 P256L probably damaging Het
Bpifb1 T C 2: 154,206,465 I140T probably damaging Het
Cat A T 2: 103,471,769 H194Q probably damaging Het
Cbfa2t3 C A 8: 122,633,409 R466L probably damaging Het
Fancm T C 12: 65,088,270 V279A probably damaging Het
Gabra2 T C 5: 71,034,762 T75A probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm3512 T A 14: 7,159,254 D7V possibly damaging Het
Gpr15 A G 16: 58,718,594 F44S probably damaging Het
Ighv1-72 C A 12: 115,758,403 C5F probably benign Het
Lilra6 A G 7: 3,911,973 L474P probably damaging Het
Mboat2 T C 12: 24,957,679 V297A probably benign Het
Muc2 C G 7: 141,752,403 C276W probably damaging Het
Ncor1 T C 11: 62,373,545 S141G possibly damaging Het
Olfr1283 T C 2: 111,369,549 *306R probably null Het
Olfr508 T G 7: 108,630,402 S137A probably benign Het
Pax5 T G 4: 44,691,955 E97A probably benign Het
Pcdhga11 A T 18: 37,757,373 D478V probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phf21b G T 15: 84,854,745 D38E probably benign Het
Ptcd1 T C 5: 145,165,071 K146R probably benign Het
Rad23a A T 8: 84,838,110 M166K probably damaging Het
Rfc4 A T 16: 23,118,066 probably null Het
Slc17a3 T A 13: 23,856,799 I336N probably benign Het
Slc2a12 T A 10: 22,665,320 M358K probably damaging Het
Stk31 T G 6: 49,469,180 M939R possibly damaging Het
Tecrl T A 5: 83,294,606 T167S probably damaging Het
Tfap2d G C 1: 19,104,478 G52R probably benign Het
Ttn C T 2: 76,941,828 V2577M probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vezt G A 10: 93,973,946 R578C probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vwa3b T A 1: 37,123,982 L562Q probably damaging Het
Zfyve27 T A 19: 42,182,755 N127K probably damaging Het
Znfx1 A G 2: 167,055,885 F373S probably damaging Het
Zswim8 G A 14: 20,714,640 V693I probably benign Het
Other mutations in As3mt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:As3mt APN 19 46720425 missense probably benign 0.06
IGL00903:As3mt APN 19 46712234 missense probably benign 0.04
IGL02190:As3mt APN 19 46719945 missense probably benign 0.38
IGL03088:As3mt APN 19 46707794 missense probably damaging 1.00
PIT4791001:As3mt UTSW 19 46720349 missense probably damaging 1.00
R1797:As3mt UTSW 19 46724934 missense possibly damaging 0.92
R2157:As3mt UTSW 19 46707792 missense probably benign 0.36
R3113:As3mt UTSW 19 46715278 splice site probably benign
R3816:As3mt UTSW 19 46707777 missense probably benign 0.32
R4819:As3mt UTSW 19 46707529 unclassified probably benign
R5053:As3mt UTSW 19 46709054 missense probably damaging 1.00
R5333:As3mt UTSW 19 46708196 missense probably null 0.97
R6003:As3mt UTSW 19 46708128 missense possibly damaging 0.85
R6269:As3mt UTSW 19 46719952 missense probably damaging 1.00
R6317:As3mt UTSW 19 46724971 missense probably benign 0.01
R6803:As3mt UTSW 19 46709581 missense probably benign 0.01
R7346:As3mt UTSW 19 46720452 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCAGCTCAGGATATTTTCTC -3'
(R):5'- CTAAAAGTGGGTTGCAGTGGC -3'

Sequencing Primer
(F):5'- CTCTCTAATAAGACTGAAGAGCTGG -3'
(R):5'- CCAACTGCGAAGAAAGTTGTTGTC -3'
Posted On2018-03-15