Incidental Mutation 'R6282:Ccdc30'
ID507989
Institutional Source Beutler Lab
Gene Symbol Ccdc30
Ensembl Gene ENSMUSG00000028637
Gene Namecoiled-coil domain containing 30
Synonyms4930445I03Rik, 1700041C02Rik, 1700001O02Rik, 1700111D19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R6282 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location119322893-119415521 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119324017 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 649 (D649V)
Ref Sequence ENSEMBL: ENSMUSP00000070621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056458] [ENSMUST00000063642] [ENSMUST00000106317] [ENSMUST00000106318] [ENSMUST00000106319] [ENSMUST00000106321] [ENSMUST00000147077]
Predicted Effect probably benign
Transcript: ENSMUST00000056458
SMART Domains Protein: ENSMUSP00000051221
Gene: ENSMUSG00000060288

DomainStartEndE-ValueType
Pfam:Pro_isomerase 14 176 5.8e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000063642
AA Change: D649V

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000070621
Gene: ENSMUSG00000028637
AA Change: D649V

DomainStartEndE-ValueType
Pfam:DUF4686 170 547 5.1e-155 PFAM
low complexity region 555 568 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106317
SMART Domains Protein: ENSMUSP00000101924
Gene: ENSMUSG00000060288

DomainStartEndE-ValueType
Pfam:Pro_isomerase 14 170 2.4e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106318
SMART Domains Protein: ENSMUSP00000101925
Gene: ENSMUSG00000060288

DomainStartEndE-ValueType
Pfam:Pro_isomerase 14 176 5.8e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106319
SMART Domains Protein: ENSMUSP00000101926
Gene: ENSMUSG00000060288

DomainStartEndE-ValueType
Pfam:Pro_isomerase 14 132 8.3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106321
SMART Domains Protein: ENSMUSP00000101928
Gene: ENSMUSG00000060288

DomainStartEndE-ValueType
Pfam:Pro_isomerase 14 176 5.8e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147077
SMART Domains Protein: ENSMUSP00000118407
Gene: ENSMUSG00000060288

DomainStartEndE-ValueType
Pfam:Pro_isomerase 2 157 2.9e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154606
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,800,769 L185Q possibly damaging Het
Abca6 A T 11: 110,208,824 C966S probably damaging Het
Atp13a4 A T 16: 29,434,004 I708N probably benign Het
Axin1 C G 17: 26,143,037 D118E probably damaging Het
Bace2 A T 16: 97,415,097 I297F probably damaging Het
C87499 T C 4: 88,630,054 E38G probably damaging Het
Cd180 G A 13: 102,693,757 A20T possibly damaging Het
Cdk18 T C 1: 132,120,020 D112G probably damaging Het
Cuedc1 A G 11: 88,183,402 N254S probably damaging Het
Dnah7a T C 1: 53,503,601 H2470R probably damaging Het
Drap1 G A 19: 5,424,436 probably null Het
Fam196b A G 11: 34,402,819 D287G possibly damaging Het
Fbxo5 T A 10: 5,801,216 K257M probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm12790 A G 4: 101,967,516 V185A possibly damaging Het
Gm7361 A G 5: 26,260,413 N136S probably benign Het
Il10ra C A 9: 45,260,405 C255F probably damaging Het
Itgam A T 7: 128,084,942 T340S probably benign Het
Ktn1 A T 14: 47,663,971 N62I probably damaging Het
Ldb2 A G 5: 44,532,665 L204P probably damaging Het
Map2k4 T C 11: 65,707,016 T90A possibly damaging Het
Mettl3 A T 14: 52,297,971 D287E probably benign Het
Mier2 A G 10: 79,544,742 F278S probably damaging Het
Mis18bp1 A G 12: 65,149,163 M609T probably benign Het
Myo1d A T 11: 80,557,512 V929D probably damaging Het
Naprt A T 15: 75,891,979 M364K probably benign Het
Nod2 T A 8: 88,670,460 C833S probably benign Het
Nrip3 C T 7: 109,763,479 probably null Het
Ntsr2 A G 12: 16,658,425 Y320C probably damaging Het
Olfr1178 C A 2: 88,391,533 C95* probably null Het
Olfr555 G A 7: 102,659,647 M275I probably benign Het
Olfr761 G A 17: 37,952,424 S200F possibly damaging Het
Osbpl3 A T 6: 50,348,083 probably null Het
Pcdhb3 C T 18: 37,301,646 R222C probably damaging Het
Pik3cd G T 4: 149,659,743 R184S probably benign Het
Rad50 A T 11: 53,669,770 probably null Het
Rad51ap2 A T 12: 11,457,559 H494L probably benign Het
Rbm25 T C 12: 83,676,089 M762T probably damaging Het
Sars G T 3: 108,428,274 S338* probably null Het
Usp35 T C 7: 97,325,948 E6G probably damaging Het
Vash2 T C 1: 190,960,225 Y251C probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdr20 T A 12: 110,797,009 probably benign Het
Wfdc1 G A 8: 119,679,407 C87Y probably damaging Het
Zfp985 T A 4: 147,583,348 H224Q probably benign Het
Other mutations in Ccdc30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Ccdc30 APN 4 119393579 missense possibly damaging 0.93
IGL01546:Ccdc30 APN 4 119398188 missense probably damaging 0.99
IGL01691:Ccdc30 APN 4 119393564 missense probably damaging 0.96
IGL02178:Ccdc30 APN 4 119349724 unclassified probably benign
IGL02341:Ccdc30 APN 4 119356781 missense possibly damaging 0.83
IGL03063:Ccdc30 APN 4 119349767 missense possibly damaging 0.68
IGL03394:Ccdc30 APN 4 119359582 missense probably damaging 1.00
R1587:Ccdc30 UTSW 4 119353176 missense probably damaging 1.00
R1604:Ccdc30 UTSW 4 119331596 missense probably damaging 0.99
R1842:Ccdc30 UTSW 4 119331127 missense probably benign
R1962:Ccdc30 UTSW 4 119339791 missense probably benign 0.00
R2157:Ccdc30 UTSW 4 119333724 splice site probably benign
R2314:Ccdc30 UTSW 4 119324566 nonsense probably null
R2362:Ccdc30 UTSW 4 119324056 missense probably damaging 0.99
R3407:Ccdc30 UTSW 4 119324581 missense possibly damaging 0.63
R3755:Ccdc30 UTSW 4 119367808 critical splice donor site probably null
R3938:Ccdc30 UTSW 4 119352673 missense probably benign 0.02
R4762:Ccdc30 UTSW 4 119333588 missense probably damaging 0.98
R5014:Ccdc30 UTSW 4 119393627 missense possibly damaging 0.96
R5635:Ccdc30 UTSW 4 119359674 missense possibly damaging 0.66
R6382:Ccdc30 UTSW 4 119404166 missense possibly damaging 0.93
R6725:Ccdc30 UTSW 4 119331599 missense probably damaging 1.00
R6746:Ccdc30 UTSW 4 119356718 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTTCTCTGGTGGAGTATTACTAACG -3'
(R):5'- GACAGGCTTCGTATTGTCAGC -3'

Sequencing Primer
(F):5'- TCTGCTACTCTAGACTCAGGAGAGC -3'
(R):5'- TGTCAGCTGAAAATCTCCAGG -3'
Posted On2018-03-15