Incidental Mutation 'R6282:Gm7361'
ID507992
Institutional Source Beutler Lab
Gene Symbol Gm7361
Ensembl Gene ENSMUSG00000059645
Gene Namepredicted gene 7361
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.045) question?
Stock #R6282 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location26257691-26264308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26260413 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 136 (N136S)
Ref Sequence ENSEMBL: ENSMUSP00000073781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074148]
Predicted Effect probably benign
Transcript: ENSMUST00000074148
AA Change: N136S

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000073781
Gene: ENSMUSG00000059645
AA Change: N136S

DomainStartEndE-ValueType
Pfam:Takusan 50 134 2.1e-26 PFAM
low complexity region 154 168 N/A INTRINSIC
low complexity region 235 259 N/A INTRINSIC
Meta Mutation Damage Score 0.1288 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,800,769 L185Q possibly damaging Het
Abca6 A T 11: 110,208,824 C966S probably damaging Het
Atp13a4 A T 16: 29,434,004 I708N probably benign Het
Axin1 C G 17: 26,143,037 D118E probably damaging Het
Bace2 A T 16: 97,415,097 I297F probably damaging Het
C87499 T C 4: 88,630,054 E38G probably damaging Het
Ccdc30 T A 4: 119,324,017 D649V probably damaging Het
Cd180 G A 13: 102,693,757 A20T possibly damaging Het
Cdk18 T C 1: 132,120,020 D112G probably damaging Het
Cuedc1 A G 11: 88,183,402 N254S probably damaging Het
Dnah7a T C 1: 53,503,601 H2470R probably damaging Het
Drap1 G A 19: 5,424,436 probably null Het
Fam196b A G 11: 34,402,819 D287G possibly damaging Het
Fbxo5 T A 10: 5,801,216 K257M probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm12790 A G 4: 101,967,516 V185A possibly damaging Het
Il10ra C A 9: 45,260,405 C255F probably damaging Het
Itgam A T 7: 128,084,942 T340S probably benign Het
Ktn1 A T 14: 47,663,971 N62I probably damaging Het
Ldb2 A G 5: 44,532,665 L204P probably damaging Het
Map2k4 T C 11: 65,707,016 T90A possibly damaging Het
Mettl3 A T 14: 52,297,971 D287E probably benign Het
Mier2 A G 10: 79,544,742 F278S probably damaging Het
Mis18bp1 A G 12: 65,149,163 M609T probably benign Het
Myo1d A T 11: 80,557,512 V929D probably damaging Het
Naprt A T 15: 75,891,979 M364K probably benign Het
Nod2 T A 8: 88,670,460 C833S probably benign Het
Nrip3 C T 7: 109,763,479 probably null Het
Ntsr2 A G 12: 16,658,425 Y320C probably damaging Het
Olfr1178 C A 2: 88,391,533 C95* probably null Het
Olfr555 G A 7: 102,659,647 M275I probably benign Het
Olfr761 G A 17: 37,952,424 S200F possibly damaging Het
Osbpl3 A T 6: 50,348,083 probably null Het
Pcdhb3 C T 18: 37,301,646 R222C probably damaging Het
Pik3cd G T 4: 149,659,743 R184S probably benign Het
Rad50 A T 11: 53,669,770 probably null Het
Rad51ap2 A T 12: 11,457,559 H494L probably benign Het
Rbm25 T C 12: 83,676,089 M762T probably damaging Het
Sars G T 3: 108,428,274 S338* probably null Het
Usp35 T C 7: 97,325,948 E6G probably damaging Het
Vash2 T C 1: 190,960,225 Y251C probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdr20 T A 12: 110,797,009 probably benign Het
Wfdc1 G A 8: 119,679,407 C87Y probably damaging Het
Zfp985 T A 4: 147,583,348 H224Q probably benign Het
Other mutations in Gm7361
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02447:Gm7361 APN 5 26257855 missense probably benign
IGL02550:Gm7361 APN 5 26261122 missense possibly damaging 0.79
R0011:Gm7361 UTSW 5 26258878 splice site probably benign
R0959:Gm7361 UTSW 5 26262053 missense possibly damaging 0.86
R1246:Gm7361 UTSW 5 26261227 nonsense probably null
R1580:Gm7361 UTSW 5 26257770 missense probably damaging 0.97
R1654:Gm7361 UTSW 5 26261099 missense probably damaging 0.99
R2065:Gm7361 UTSW 5 26262151 missense probably damaging 1.00
R4864:Gm7361 UTSW 5 26262010 critical splice acceptor site probably null
R5386:Gm7361 UTSW 5 26258905 missense probably benign
R6391:Gm7361 UTSW 5 26258962 missense probably benign 0.37
R6769:Gm7361 UTSW 5 26257769 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTTCCATGGCTGCAGTAGTC -3'
(R):5'- AAGAGTCCCTTAGAGGCCTAGG -3'

Sequencing Primer
(F):5'- ATGGCTGCAGTAGTCCAGGAC -3'
(R):5'- GTCCCTTAGAGGCCTAGGAAAAC -3'
Posted On2018-03-15