Incidental Mutation 'R6282:Osbpl3'
ID507994
Institutional Source Beutler Lab
Gene Symbol Osbpl3
Ensembl Gene ENSMUSG00000029822
Gene Nameoxysterol binding protein-like 3
Synonyms6720421I08Rik, OSBP3, ORP3, 1200014M06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6282 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location50293330-50456201 bp(-) (GRCm38)
Type of Mutationunclassified (2 bp from exon)
DNA Base Change (assembly) A to T at 50348083 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071728] [ENSMUST00000090019] [ENSMUST00000114466] [ENSMUST00000114468] [ENSMUST00000136926] [ENSMUST00000146341] [ENSMUST00000203907]
Predicted Effect probably benign
Transcript: ENSMUST00000071728
AA Change: M145K

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000071643
Gene: ENSMUSG00000029822
AA Change: M145K

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
PH 51 147 9.56e-11 SMART
low complexity region 177 191 N/A INTRINSIC
Blast:PH 254 311 4e-25 BLAST
low complexity region 392 425 N/A INTRINSIC
Pfam:Oxysterol_BP 459 804 3.2e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090019
AA Change: M145K

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000087473
Gene: ENSMUSG00000029822
AA Change: M145K

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
PH 51 147 9.56e-11 SMART
low complexity region 177 191 N/A INTRINSIC
Blast:PH 288 342 4e-25 BLAST
low complexity region 459 492 N/A INTRINSIC
Pfam:Oxysterol_BP 526 870 3e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114466
AA Change: M145K

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000110110
Gene: ENSMUSG00000029822
AA Change: M145K

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
PH 51 147 9.56e-11 SMART
low complexity region 177 191 N/A INTRINSIC
Blast:PH 288 342 3e-25 BLAST
low complexity region 423 456 N/A INTRINSIC
Pfam:Oxysterol_BP 490 835 3.5e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114468
AA Change: M145K

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000110112
Gene: ENSMUSG00000029822
AA Change: M145K

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
PH 51 147 9.56e-11 SMART
low complexity region 177 191 N/A INTRINSIC
Blast:PH 254 311 4e-25 BLAST
low complexity region 428 461 N/A INTRINSIC
Pfam:Oxysterol_BP 495 840 1.3e-138 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133141
Predicted Effect probably benign
Transcript: ENSMUST00000136926
SMART Domains Protein: ENSMUSP00000144934
Gene: ENSMUSG00000029822

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
SCOP:d1btka_ 50 75 5e-4 SMART
Blast:PH 51 76 1e-11 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000146341
SMART Domains Protein: ENSMUSP00000114472
Gene: ENSMUSG00000029822

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
PH 51 144 1.27e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203907
SMART Domains Protein: ENSMUSP00000145249
Gene: ENSMUSG00000029822

DomainStartEndE-ValueType
Blast:PH 1 91 1e-57 BLAST
low complexity region 208 241 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Most members contain an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain. The encoded protein is involved in the regulation of cell adhesion and organization of the actin cytoskeleton. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,800,769 L185Q possibly damaging Het
Abca6 A T 11: 110,208,824 C966S probably damaging Het
Atp13a4 A T 16: 29,434,004 I708N probably benign Het
Axin1 C G 17: 26,143,037 D118E probably damaging Het
Bace2 A T 16: 97,415,097 I297F probably damaging Het
C87499 T C 4: 88,630,054 E38G probably damaging Het
Ccdc30 T A 4: 119,324,017 D649V probably damaging Het
Cd180 G A 13: 102,693,757 A20T possibly damaging Het
Cdk18 T C 1: 132,120,020 D112G probably damaging Het
Cuedc1 A G 11: 88,183,402 N254S probably damaging Het
Dnah7a T C 1: 53,503,601 H2470R probably damaging Het
Drap1 G A 19: 5,424,436 probably null Het
Fam196b A G 11: 34,402,819 D287G possibly damaging Het
Fbxo5 T A 10: 5,801,216 K257M probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm12790 A G 4: 101,967,516 V185A possibly damaging Het
Gm7361 A G 5: 26,260,413 N136S probably benign Het
Il10ra C A 9: 45,260,405 C255F probably damaging Het
Itgam A T 7: 128,084,942 T340S probably benign Het
Ktn1 A T 14: 47,663,971 N62I probably damaging Het
Ldb2 A G 5: 44,532,665 L204P probably damaging Het
Map2k4 T C 11: 65,707,016 T90A possibly damaging Het
Mettl3 A T 14: 52,297,971 D287E probably benign Het
Mier2 A G 10: 79,544,742 F278S probably damaging Het
Mis18bp1 A G 12: 65,149,163 M609T probably benign Het
Myo1d A T 11: 80,557,512 V929D probably damaging Het
Naprt A T 15: 75,891,979 M364K probably benign Het
Nod2 T A 8: 88,670,460 C833S probably benign Het
Nrip3 C T 7: 109,763,479 probably null Het
Ntsr2 A G 12: 16,658,425 Y320C probably damaging Het
Olfr1178 C A 2: 88,391,533 C95* probably null Het
Olfr555 G A 7: 102,659,647 M275I probably benign Het
Olfr761 G A 17: 37,952,424 S200F possibly damaging Het
Pcdhb3 C T 18: 37,301,646 R222C probably damaging Het
Pik3cd G T 4: 149,659,743 R184S probably benign Het
Rad50 A T 11: 53,669,770 probably null Het
Rad51ap2 A T 12: 11,457,559 H494L probably benign Het
Rbm25 T C 12: 83,676,089 M762T probably damaging Het
Sars G T 3: 108,428,274 S338* probably null Het
Usp35 T C 7: 97,325,948 E6G probably damaging Het
Vash2 T C 1: 190,960,225 Y251C probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdr20 T A 12: 110,797,009 probably benign Het
Wfdc1 G A 8: 119,679,407 C87Y probably damaging Het
Zfp985 T A 4: 147,583,348 H224Q probably benign Het
Other mutations in Osbpl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Osbpl3 APN 6 50323068 missense probably damaging 1.00
IGL01784:Osbpl3 APN 6 50344922 missense probably damaging 1.00
IGL02221:Osbpl3 APN 6 50327367 unclassified probably benign
IGL02323:Osbpl3 APN 6 50346326 critical splice donor site probably null
IGL02894:Osbpl3 APN 6 50346332 missense possibly damaging 0.89
H8562:Osbpl3 UTSW 6 50347466 missense probably benign 0.09
PIT4283001:Osbpl3 UTSW 6 50346088 missense probably benign 0.01
R0226:Osbpl3 UTSW 6 50353008 missense probably damaging 1.00
R0416:Osbpl3 UTSW 6 50348018 missense probably benign
R0417:Osbpl3 UTSW 6 50348018 missense probably benign
R0601:Osbpl3 UTSW 6 50299403 missense probably benign 0.05
R0826:Osbpl3 UTSW 6 50346377 missense probably damaging 1.00
R1390:Osbpl3 UTSW 6 50308427 missense probably damaging 1.00
R1520:Osbpl3 UTSW 6 50346431 missense possibly damaging 0.75
R1603:Osbpl3 UTSW 6 50323093 missense probably damaging 1.00
R1678:Osbpl3 UTSW 6 50336213 critical splice donor site probably null
R1843:Osbpl3 UTSW 6 50370143 missense probably damaging 1.00
R1943:Osbpl3 UTSW 6 50320074 missense probably benign 0.16
R3435:Osbpl3 UTSW 6 50348070 missense possibly damaging 0.94
R3768:Osbpl3 UTSW 6 50348002 missense possibly damaging 0.64
R4746:Osbpl3 UTSW 6 50328674 missense probably damaging 0.99
R4751:Osbpl3 UTSW 6 50300997 missense possibly damaging 0.95
R4776:Osbpl3 UTSW 6 50300973 missense probably benign 0.01
R4814:Osbpl3 UTSW 6 50353000 missense probably damaging 1.00
R4841:Osbpl3 UTSW 6 50309376 missense probably damaging 1.00
R4881:Osbpl3 UTSW 6 50352784 missense possibly damaging 0.95
R4999:Osbpl3 UTSW 6 50336297 missense probably damaging 0.99
R5512:Osbpl3 UTSW 6 50309360 missense probably damaging 0.98
R6304:Osbpl3 UTSW 6 50312674 missense probably damaging 1.00
R6905:Osbpl3 UTSW 6 50351882 missense probably damaging 1.00
R7000:Osbpl3 UTSW 6 50297157 missense probably damaging 1.00
R7102:Osbpl3 UTSW 6 50320135 missense probably damaging 1.00
R7275:Osbpl3 UTSW 6 50346430 missense probably benign 0.02
R7334:Osbpl3 UTSW 6 50344906 missense possibly damaging 0.78
R7368:Osbpl3 UTSW 6 50348098 missense probably damaging 1.00
Z1088:Osbpl3 UTSW 6 50297097 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGGTCAAGAGACTAACTGGG -3'
(R):5'- GTCCTCCGAGACCACATAAATG -3'

Sequencing Primer
(F):5'- GTACCAACCTCCAACCTACCCTG -3'
(R):5'- CCAAGACAGTACATGCAGTTTC -3'
Posted On2018-03-15