Incidental Mutation 'R6282:Cuedc1'
ID508008
Institutional Source Beutler Lab
Gene Symbol Cuedc1
Ensembl Gene ENSMUSG00000018378
Gene NameCUE domain containing 1
SynonymsC330016O16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6282 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location88098058-88194140 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88183402 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 254 (N254S)
Ref Sequence ENSEMBL: ENSMUSP00000120867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018522] [ENSMUST00000154812]
Predicted Effect probably damaging
Transcript: ENSMUST00000018522
AA Change: N254S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000018522
Gene: ENSMUSG00000018378
AA Change: N254S

DomainStartEndE-ValueType
low complexity region 6 33 N/A INTRINSIC
CUE 50 92 6.55e-15 SMART
low complexity region 94 110 N/A INTRINSIC
low complexity region 121 136 N/A INTRINSIC
low complexity region 207 222 N/A INTRINSIC
low complexity region 331 340 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125297
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132377
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142564
Predicted Effect probably damaging
Transcript: ENSMUST00000154812
AA Change: N254S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120867
Gene: ENSMUSG00000018378
AA Change: N254S

DomainStartEndE-ValueType
low complexity region 6 33 N/A INTRINSIC
CUE 50 92 6.55e-15 SMART
low complexity region 94 110 N/A INTRINSIC
low complexity region 121 136 N/A INTRINSIC
low complexity region 207 222 N/A INTRINSIC
Meta Mutation Damage Score 0.088 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,800,769 L185Q possibly damaging Het
Abca6 A T 11: 110,208,824 C966S probably damaging Het
Atp13a4 A T 16: 29,434,004 I708N probably benign Het
Axin1 C G 17: 26,143,037 D118E probably damaging Het
Bace2 A T 16: 97,415,097 I297F probably damaging Het
C87499 T C 4: 88,630,054 E38G probably damaging Het
Ccdc30 T A 4: 119,324,017 D649V probably damaging Het
Cd180 G A 13: 102,693,757 A20T possibly damaging Het
Cdk18 T C 1: 132,120,020 D112G probably damaging Het
Dnah7a T C 1: 53,503,601 H2470R probably damaging Het
Drap1 G A 19: 5,424,436 probably null Het
Fam196b A G 11: 34,402,819 D287G possibly damaging Het
Fbxo5 T A 10: 5,801,216 K257M probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm12790 A G 4: 101,967,516 V185A possibly damaging Het
Gm7361 A G 5: 26,260,413 N136S probably benign Het
Il10ra C A 9: 45,260,405 C255F probably damaging Het
Itgam A T 7: 128,084,942 T340S probably benign Het
Ktn1 A T 14: 47,663,971 N62I probably damaging Het
Ldb2 A G 5: 44,532,665 L204P probably damaging Het
Map2k4 T C 11: 65,707,016 T90A possibly damaging Het
Mettl3 A T 14: 52,297,971 D287E probably benign Het
Mier2 A G 10: 79,544,742 F278S probably damaging Het
Mis18bp1 A G 12: 65,149,163 M609T probably benign Het
Myo1d A T 11: 80,557,512 V929D probably damaging Het
Naprt A T 15: 75,891,979 M364K probably benign Het
Nod2 T A 8: 88,670,460 C833S probably benign Het
Nrip3 C T 7: 109,763,479 probably null Het
Ntsr2 A G 12: 16,658,425 Y320C probably damaging Het
Olfr1178 C A 2: 88,391,533 C95* probably null Het
Olfr555 G A 7: 102,659,647 M275I probably benign Het
Olfr761 G A 17: 37,952,424 S200F possibly damaging Het
Osbpl3 A T 6: 50,348,083 probably null Het
Pcdhb3 C T 18: 37,301,646 R222C probably damaging Het
Pik3cd G T 4: 149,659,743 R184S probably benign Het
Rad50 A T 11: 53,669,770 probably null Het
Rad51ap2 A T 12: 11,457,559 H494L probably benign Het
Rbm25 T C 12: 83,676,089 M762T probably damaging Het
Sars G T 3: 108,428,274 S338* probably null Het
Usp35 T C 7: 97,325,948 E6G probably damaging Het
Vash2 T C 1: 190,960,225 Y251C probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdr20 T A 12: 110,797,009 probably benign Het
Wfdc1 G A 8: 119,679,407 C87Y probably damaging Het
Zfp985 T A 4: 147,583,348 H224Q probably benign Het
Other mutations in Cuedc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Cuedc1 APN 11 88183254 missense possibly damaging 0.56
IGL02103:Cuedc1 APN 11 88188799 missense probably damaging 0.99
IGL02325:Cuedc1 APN 11 88170173 missense probably null 1.00
IGL03001:Cuedc1 APN 11 88182489 missense probably benign 0.02
IGL03245:Cuedc1 APN 11 88177262 splice site probably benign
R0242:Cuedc1 UTSW 11 88184621 splice site probably benign
R0511:Cuedc1 UTSW 11 88183405 missense probably damaging 1.00
R1013:Cuedc1 UTSW 11 88188027 missense possibly damaging 0.68
R1382:Cuedc1 UTSW 11 88177363 missense probably benign 0.08
R2004:Cuedc1 UTSW 11 88177390 missense probably damaging 1.00
R5320:Cuedc1 UTSW 11 88177310 missense probably damaging 1.00
R5381:Cuedc1 UTSW 11 88187986 splice site probably null
R5782:Cuedc1 UTSW 11 88170032 missense probably damaging 1.00
R6918:Cuedc1 UTSW 11 88187073 missense probably benign 0.00
R7329:Cuedc1 UTSW 11 88169866 missense unknown
Predicted Primers PCR Primer
(F):5'- TGCGCATACAGCTGTACATGG -3'
(R):5'- AAACCCGGAGCTCCTGAATG -3'

Sequencing Primer
(F):5'- CGCATACAGCTGTACATGGATTTAAG -3'
(R):5'- GAGCTCCTGAATGACCCAG -3'
Posted On2018-03-15