Incidental Mutation 'R6283:Vmn2r111'
ID508079
Institutional Source Beutler Lab
Gene Symbol Vmn2r111
Ensembl Gene ENSMUSG00000095093
Gene Namevomeronasal 2, receptor 111
SynonymsEG210876
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R6283 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location22547941-22573273 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22559051 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 549 (N549S)
Ref Sequence ENSEMBL: ENSMUSP00000090148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092491]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092491
AA Change: N549S

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: N549S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.5e-29 PFAM
Pfam:NCD3G 512 565 1.1e-20 PFAM
Pfam:7tm_3 595 833 5.6e-54 PFAM
Meta Mutation Damage Score 0.0676 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik G A 9: 103,282,635 R14* probably null Het
Acsf3 C A 8: 122,785,955 R372S probably damaging Het
Adamts20 A G 15: 94,351,721 S472P probably benign Het
Bhlhe40 T C 6: 108,665,031 L312P probably damaging Het
Ccdc180 A G 4: 45,902,486 E305G possibly damaging Het
Ccdc83 T A 7: 90,236,407 R257* probably null Het
Cd209e G A 8: 3,849,212 Q167* probably null Het
Cd300e G A 11: 115,054,554 T138I probably benign Het
Ces2c A T 8: 104,849,699 M115L probably benign Het
Cfap61 T A 2: 146,129,102 probably null Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cic C T 7: 25,286,034 S301L probably damaging Het
Cks2 A G 13: 51,645,459 H16R probably benign Het
Copa A T 1: 172,118,848 H953L possibly damaging Het
Ctdsp2 T C 10: 126,995,880 V145A possibly damaging Het
Cyp2j13 A G 4: 96,056,837 V377A possibly damaging Het
Dhx57 A G 17: 80,274,805 V404A probably benign Het
Dock2 T C 11: 34,707,325 S340G probably damaging Het
Ggps1 A G 13: 14,057,794 probably null Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11444 T C 11: 85,846,791 probably null Het
Gm853 A G 4: 130,221,741 S5P probably benign Het
Grina A G 15: 76,248,551 T173A possibly damaging Het
Hcrtr1 G A 4: 130,135,340 T223I probably benign Het
Igsf10 T A 3: 59,319,449 T2268S probably damaging Het
Ino80d C T 1: 63,062,126 R447Q probably damaging Het
Inpp4b C T 8: 81,770,833 T94M probably damaging Het
Itga2 A G 13: 114,869,250 Y465H probably damaging Het
Knl1 A G 2: 119,070,286 T823A probably damaging Het
Krtap4-16 A G 11: 99,851,035 S180P unknown Het
Lpar6 A T 14: 73,238,857 D86V probably damaging Het
Muc5ac C A 7: 141,816,864 C2500* probably null Het
Mzf1 T C 7: 13,053,369 probably benign Het
Olfr1032 G T 2: 86,008,099 V108L possibly damaging Het
Olfr1176 T A 2: 88,339,658 I31N probably benign Het
Olfr1311 A C 2: 112,021,260 M198R possibly damaging Het
Olfr1352 T C 10: 78,984,279 V163A probably benign Het
Otogl T G 10: 107,790,500 E1501A probably damaging Het
Pcdh10 T A 3: 45,381,554 S768T possibly damaging Het
Pcnx2 G T 8: 125,877,586 Q644K probably damaging Het
Pdzd9 T A 7: 120,660,226 I180F possibly damaging Het
Pinx1 A C 14: 63,878,172 N152T probably benign Het
Prr14l T C 5: 32,830,264 E629G probably benign Het
Qpctl T A 7: 19,148,420 I104F probably benign Het
Rabep1 C T 11: 70,917,679 A444V probably damaging Het
Rnf150 A G 8: 82,990,554 Y230C probably damaging Het
Slc25a27 A C 17: 43,657,730 V152G probably damaging Het
Swt1 A G 1: 151,384,333 S772P possibly damaging Het
Tenm4 A G 7: 96,874,494 T1711A probably benign Het
Tfap2d G C 1: 19,104,478 G52R probably benign Het
Tmem265 T G 7: 127,564,872 V86G possibly damaging Het
Trpm8 C T 1: 88,348,332 H551Y probably benign Het
Ttc6 T G 12: 57,702,262 Y1327D possibly damaging Het
Uevld G T 7: 46,937,981 Q324K possibly damaging Het
Vmn2r73 C T 7: 85,871,841 M306I probably benign Het
Vmn2r93 T A 17: 18,304,104 M120K probably benign Het
Zfp804b T A 5: 6,769,908 I1016F probably benign Het
Zfp90 T C 8: 106,425,394 C580R probably damaging Het
Other mutations in Vmn2r111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Vmn2r111 APN 17 22548753 missense probably benign 0.00
IGL01306:Vmn2r111 APN 17 22568984 missense probably damaging 0.99
IGL01309:Vmn2r111 APN 17 22569016 missense possibly damaging 0.51
IGL01457:Vmn2r111 APN 17 22571985 nonsense probably null
IGL01465:Vmn2r111 APN 17 22548737 missense probably benign 0.00
IGL01505:Vmn2r111 APN 17 22548572 missense probably benign 0.00
IGL01571:Vmn2r111 APN 17 22571392 missense probably damaging 0.99
IGL01715:Vmn2r111 APN 17 22569073 splice site probably benign
IGL01962:Vmn2r111 APN 17 22548284 missense possibly damaging 0.90
IGL02190:Vmn2r111 APN 17 22570773 missense probably benign 0.00
IGL02496:Vmn2r111 APN 17 22568856 missense probably benign
IGL02519:Vmn2r111 APN 17 22548339 missense possibly damaging 0.80
IGL02616:Vmn2r111 APN 17 22571050 missense possibly damaging 0.67
IGL02641:Vmn2r111 APN 17 22573224 missense possibly damaging 0.82
IGL02690:Vmn2r111 APN 17 22559042 critical splice donor site probably null
IGL02698:Vmn2r111 APN 17 22571245 missense probably damaging 1.00
IGL03017:Vmn2r111 APN 17 22570858 missense probably damaging 1.00
R0046:Vmn2r111 UTSW 17 22548009 missense probably benign
R0064:Vmn2r111 UTSW 17 22572072 missense probably benign 0.00
R0519:Vmn2r111 UTSW 17 22573121 missense probably benign 0.02
R1439:Vmn2r111 UTSW 17 22571116 missense probably benign 0.00
R1467:Vmn2r111 UTSW 17 22571047 missense probably damaging 0.99
R1467:Vmn2r111 UTSW 17 22571047 missense probably damaging 0.99
R1636:Vmn2r111 UTSW 17 22571399 missense probably damaging 1.00
R1647:Vmn2r111 UTSW 17 22569061 missense probably benign 0.03
R1648:Vmn2r111 UTSW 17 22569061 missense probably benign 0.03
R1697:Vmn2r111 UTSW 17 22548060 missense probably benign 0.26
R1996:Vmn2r111 UTSW 17 22548081 missense probably benign 0.21
R2040:Vmn2r111 UTSW 17 22548414 missense probably damaging 1.00
R2075:Vmn2r111 UTSW 17 22559062 missense probably damaging 1.00
R2134:Vmn2r111 UTSW 17 22573104 missense possibly damaging 0.68
R2357:Vmn2r111 UTSW 17 22559170 splice site probably benign
R3700:Vmn2r111 UTSW 17 22571161 nonsense probably null
R3782:Vmn2r111 UTSW 17 22571320 missense possibly damaging 0.89
R4085:Vmn2r111 UTSW 17 22559115 missense probably benign 0.00
R4323:Vmn2r111 UTSW 17 22573178 missense probably benign 0.02
R4900:Vmn2r111 UTSW 17 22548656 missense possibly damaging 0.94
R5072:Vmn2r111 UTSW 17 22548041 missense probably damaging 0.99
R5123:Vmn2r111 UTSW 17 22571143 missense possibly damaging 0.82
R5181:Vmn2r111 UTSW 17 22571020 missense possibly damaging 0.56
R5357:Vmn2r111 UTSW 17 22548102 nonsense probably null
R5398:Vmn2r111 UTSW 17 22573271 start codon destroyed probably null 0.88
R5434:Vmn2r111 UTSW 17 22548489 missense probably damaging 0.99
R5462:Vmn2r111 UTSW 17 22548257 missense probably damaging 1.00
R6149:Vmn2r111 UTSW 17 22548815 missense probably benign 0.00
R6149:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6207:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6281:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6282:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6307:Vmn2r111 UTSW 17 22573089 missense probably benign 0.00
R6323:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6325:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6367:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6368:Vmn2r111 UTSW 17 22571908 missense probably benign 0.38
R6369:Vmn2r111 UTSW 17 22548602 missense probably damaging 1.00
R6489:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6490:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6546:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6547:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6557:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6654:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6655:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6657:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6659:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6660:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6664:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6798:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6799:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6801:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6893:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6895:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6897:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6922:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6923:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6944:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6945:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
X0026:Vmn2r111 UTSW 17 22548695 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAAGATGCAGCCCAATTTCTAC -3'
(R):5'- TCAAGGAGTTGGGAAACAATTCAAC -3'

Sequencing Primer
(F):5'- TGAGTAACTTAGGACAGAGAT -3'
(R):5'- ACAATGCACTAAATAAGGTCTGC -3'
Posted On2018-03-15