Incidental Mutation 'R6284:Ppa2'
ID508094
Institutional Source Beutler Lab
Gene Symbol Ppa2
Ensembl Gene ENSMUSG00000028013
Gene Namepyrophosphatase (inorganic) 2
Synonyms1110013G13Rik, Sid6306
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.873) question?
Stock #R6284 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location133310110-133378235 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 133370417 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 269 (R269H)
Ref Sequence ENSEMBL: ENSMUSP00000113369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029644] [ENSMUST00000106315] [ENSMUST00000122334]
Predicted Effect probably benign
Transcript: ENSMUST00000029644
AA Change: R269H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029644
Gene: ENSMUSG00000028013
AA Change: R269H

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
Pfam:Pyrophosphatase 89 271 8.4e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106315
AA Change: R94H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101922
Gene: ENSMUSG00000028013
AA Change: R94H

DomainStartEndE-ValueType
Pfam:Pyrophosphatase 1 97 7.6e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122334
AA Change: R269H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113369
Gene: ENSMUSG00000028013
AA Change: R269H

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
Pfam:Pyrophosphatase 88 272 1.5e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125858
SMART Domains Protein: ENSMUSP00000117201
Gene: ENSMUSG00000028013

DomainStartEndE-ValueType
Pfam:Pyrophosphatase 37 146 8.8e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150386
SMART Domains Protein: ENSMUSP00000115462
Gene: ENSMUSG00000028013

DomainStartEndE-ValueType
Pfam:Pyrophosphatase 15 132 1.7e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153387
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196807
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is localized to the mitochondrion, is highly similar to members of the inorganic pyrophosphatase (PPase) family, and contains the signature sequence essential for the catalytic activity of PPase. PPases catalyze the hydrolysis of pyrophosphate to inorganic phosphate, which is important for the phosphate metabolism of cells. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik G T 6: 72,347,454 G16C probably damaging Het
Abca7 G A 10: 80,004,410 V801I probably benign Het
Adgrl2 A T 3: 148,826,507 L1030Q probably damaging Het
Akap1 T C 11: 88,844,568 T423A possibly damaging Het
Anpep T A 7: 79,825,802 D111V probably damaging Het
Atm T A 9: 53,445,376 probably null Het
Atp5a1 T A 18: 77,778,468 S106T probably benign Het
Atp5k T C 5: 108,434,059 I20V probably benign Het
Atp6v0d2 T A 4: 19,922,605 probably null Het
Bclaf1 T G 10: 20,322,160 probably null Het
Bod1l A G 5: 41,818,787 V1728A probably benign Het
Braf A G 6: 39,688,282 F51L possibly damaging Het
Camsap2 A G 1: 136,304,437 I140T possibly damaging Het
Ccdc24 A T 4: 117,869,653 probably null Het
Cdh26 G C 2: 178,449,884 G79R probably damaging Het
Cenpf A G 1: 189,652,742 L2447P probably damaging Het
Cfap74 T C 4: 155,451,796 F863L probably damaging Het
Clstn2 C T 9: 97,454,674 G917S probably benign Het
Col6a6 A T 9: 105,727,227 probably null Het
Cul5 G A 9: 53,623,735 P596L probably damaging Het
Dst A T 1: 34,229,085 R2863W probably damaging Het
Dthd1 A G 5: 62,814,041 E69G possibly damaging Het
Erich2 T A 2: 70,539,684 I402N probably damaging Het
Fam160a1 G A 3: 85,672,688 P737S probably benign Het
Fam162b T C 10: 51,585,502 K155R probably damaging Het
Glb1l2 A T 9: 26,767,448 S466T probably benign Het
Gm21994 T A 2: 150,255,278 Y77F possibly damaging Het
Gm5724 T C 6: 141,725,393 D451G probably damaging Het
Ikbkap A T 4: 56,762,281 I1106K probably damaging Het
Kazn G A 4: 142,117,197 L402F probably benign Het
Kcnj13 A T 1: 87,386,886 S205T probably damaging Het
Lama1 T A 17: 67,810,096 V2462E probably damaging Het
Lce1b A C 3: 92,656,104 C41G unknown Het
Lyar T A 5: 38,225,995 W77R probably damaging Het
March11 G A 15: 26,409,346 R377Q probably benign Het
Mis18bp1 A G 12: 65,138,787 F869L probably benign Het
Myom1 T A 17: 71,022,892 Y6* probably null Het
Myzap T C 9: 71,558,925 I150V probably benign Het
Nop14 C T 5: 34,641,491 probably null Het
Oprl1 T A 2: 181,717,991 probably benign Het
Pacsin1 T C 17: 27,708,504 L432P probably damaging Het
Peak1 A G 9: 56,260,296 L116P probably benign Het
Plcb2 C T 2: 118,717,301 V482M probably benign Het
Pnliprp1 T A 19: 58,734,984 I269N probably damaging Het
Pnpla7 C A 2: 25,016,618 D664E possibly damaging Het
Rps6kb2 G T 19: 4,161,187 T113K probably benign Het
Rrp7a A T 15: 83,121,860 I63N probably damaging Het
Slc29a1 A G 17: 45,589,921 probably null Het
Stxbp5 A C 10: 9,767,179 S1059A probably benign Het
Stxbp5 C A 10: 9,767,187 G1056V probably damaging Het
Taldo1 T A 7: 141,398,583 S149T possibly damaging Het
Tlr1 T C 5: 64,927,099 D45G possibly damaging Het
Tnrc6a T C 7: 123,171,335 S783P probably damaging Het
Trap1 A G 16: 4,060,809 Y220H probably benign Het
Trpc6 A G 9: 8,643,600 D462G possibly damaging Het
Ttc21a A G 9: 119,943,962 E235G probably damaging Het
Tubb4a A G 17: 57,080,833 Y398H probably damaging Het
Ube2z A G 11: 96,050,407 F303S probably damaging Het
Vmn1r211 A G 13: 22,852,084 S138P probably damaging Het
Zfp93 T A 7: 24,275,629 C346* probably null Het
Zfp938 A T 10: 82,227,566 S52R possibly damaging Het
Zp1 A T 19: 10,916,503 L446Q probably damaging Het
Other mutations in Ppa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02070:Ppa2 APN 3 133377862 missense probably damaging 1.00
IGL02662:Ppa2 APN 3 133367883 missense probably damaging 0.99
IGL02726:Ppa2 APN 3 133370461 missense possibly damaging 0.46
R0098:Ppa2 UTSW 3 133370473 splice site probably benign
R0098:Ppa2 UTSW 3 133370473 splice site probably benign
R1868:Ppa2 UTSW 3 133348097 missense probably damaging 1.00
R2082:Ppa2 UTSW 3 133370417 missense probably benign 0.00
R2096:Ppa2 UTSW 3 133326684 missense probably damaging 1.00
R2851:Ppa2 UTSW 3 133321003 splice site probably null
R3611:Ppa2 UTSW 3 133348106 missense probably benign 0.07
R4299:Ppa2 UTSW 3 133367842 missense probably damaging 1.00
R4660:Ppa2 UTSW 3 133326684 missense probably damaging 1.00
R4735:Ppa2 UTSW 3 133370425 missense probably benign 0.29
R5023:Ppa2 UTSW 3 133370434 missense probably benign 0.08
R5881:Ppa2 UTSW 3 133330439 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGACTAAGGCAGCTTTTCCAC -3'
(R):5'- TGAACCACTTTGGATTCCTAGC -3'

Sequencing Primer
(F):5'- AAGGCAGCTTTTCCACTCGTTTG -3'
(R):5'- CAGCTACCACTAAAGAGATGTTCTG -3'
Posted On2018-03-15