Incidental Mutation 'R6284:Adgrl2'
ID508095
Institutional Source Beutler Lab
Gene Symbol Adgrl2
Ensembl Gene ENSMUSG00000028184
Gene Nameadhesion G protein-coupled receptor L2
SynonymsLec1, Lphn2, Lphh1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6284 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location148815583-148990555 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 148826507 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 1030 (L1030Q)
Ref Sequence ENSEMBL: ENSMUSP00000142336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106128] [ENSMUST00000168352] [ENSMUST00000195988] [ENSMUST00000196526] [ENSMUST00000197567] [ENSMUST00000198779] [ENSMUST00000199059] [ENSMUST00000199238] [ENSMUST00000199750] [ENSMUST00000200154] [ENSMUST00000200543]
Predicted Effect probably damaging
Transcript: ENSMUST00000106128
AA Change: L1071Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101734
Gene: ENSMUSG00000028184
AA Change: L1071Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 2.5e-26 PFAM
OLF 142 398 5.22e-140 SMART
HormR 469 534 3.14e-20 SMART
Pfam:GAIN 537 764 1.3e-58 PFAM
GPS 788 840 3.47e-25 SMART
Pfam:7tm_2 848 1108 4.6e-69 PFAM
Pfam:Latrophilin 1128 1487 6.4e-181 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168352
SMART Domains Protein: ENSMUSP00000132116
Gene: ENSMUSG00000028184

DomainStartEndE-ValueType
Pfam:Latrophilin 1 239 2.5e-122 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000195988
AA Change: L1062Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143444
Gene: ENSMUSG00000028184
AA Change: L1062Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.3e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 469 534 2e-22 SMART
GPS 788 840 2.1e-27 SMART
Pfam:7tm_2 848 1099 8.1e-66 PFAM
Pfam:Latrophilin 1119 1189 2.2e-28 PFAM
Pfam:Latrophilin 1184 1435 5.5e-123 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196526
AA Change: L1030Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143788
Gene: ENSMUSG00000028184
AA Change: L1030Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 8.7e-24 PFAM
OLF 138 394 3.4e-142 SMART
HormR 465 530 2e-22 SMART
Pfam:GAIN 533 747 1.1e-54 PFAM
GPS 771 823 2.2e-27 SMART
Pfam:7tm_2 831 1067 6.5e-68 PFAM
Pfam:Latrophilin 1087 1158 9.9e-36 PFAM
low complexity region 1163 1173 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000197348
AA Change: L62Q
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197521
Predicted Effect probably damaging
Transcript: ENSMUST00000197567
AA Change: L1071Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143626
Gene: ENSMUSG00000028184
AA Change: L1071Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 1.9e-26 PFAM
OLF 142 398 5.22e-140 SMART
HormR 469 534 3.14e-20 SMART
Pfam:GAIN 537 764 1.1e-58 PFAM
GPS 788 840 3.47e-25 SMART
Pfam:7tm_2 848 1108 6.4e-69 PFAM
Pfam:Latrophilin 1128 1487 2.8e-181 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000197925
AA Change: L91Q
Predicted Effect unknown
Transcript: ENSMUST00000198139
AA Change: L48Q
Predicted Effect probably damaging
Transcript: ENSMUST00000198779
AA Change: L1047Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142347
Gene: ENSMUSG00000028184
AA Change: L1047Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.4e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 469 534 2e-22 SMART
GPS 788 840 2.1e-27 SMART
Pfam:7tm_2 848 1084 1.8e-66 PFAM
Pfam:Latrophilin 1104 1452 7e-174 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199059
AA Change: L1062Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143150
Gene: ENSMUSG00000028184
AA Change: L1062Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.4e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 469 534 2e-22 SMART
GPS 788 840 2.1e-27 SMART
Pfam:7tm_2 848 1099 8.3e-66 PFAM
Pfam:Latrophilin 1119 1467 7.1e-174 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199238
AA Change: L1062Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142405
Gene: ENSMUSG00000028184
AA Change: L1062Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.4e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 469 534 2e-22 SMART
GPS 788 840 2.1e-27 SMART
Pfam:7tm_2 848 1099 8.4e-66 PFAM
Pfam:Latrophilin 1119 1478 1.6e-187 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199750
AA Change: L968Q

PolyPhen 2 Score 0.193 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000143320
Gene: ENSMUSG00000028184
AA Change: L968Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.1e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 403 468 1.9e-22 SMART
GPS 709 761 2.1e-27 SMART
Pfam:7tm_2 769 1005 1.6e-66 PFAM
Pfam:Latrophilin 1025 1095 2e-28 PFAM
Pfam:Latrophilin 1090 1341 4.9e-123 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200023
Predicted Effect probably damaging
Transcript: ENSMUST00000200154
AA Change: L1030Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142865
Gene: ENSMUSG00000028184
AA Change: L1030Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 2.5e-23 PFAM
OLF 138 394 3.3e-142 SMART
HormR 465 530 2e-22 SMART
GPS 771 823 2.1e-27 SMART
Pfam:7tm_2 831 1067 1.2e-66 PFAM
Pfam:Latrophilin 1087 1123 2.2e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200216
Predicted Effect probably benign
Transcript: ENSMUST00000200456
Predicted Effect probably damaging
Transcript: ENSMUST00000200543
AA Change: L1030Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142336
Gene: ENSMUSG00000028184
AA Change: L1030Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.2e-23 PFAM
OLF 138 394 3.3e-142 SMART
HormR 465 530 2e-22 SMART
GPS 771 823 2.1e-27 SMART
Pfam:7tm_2 831 1067 1.7e-66 PFAM
Pfam:Latrophilin 1087 1157 2.1e-28 PFAM
Pfam:Latrophilin 1152 1403 5.3e-123 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the latrophilin subfamily of G-protein coupled receptors. The encoded protein participates in the regulation of exocytosis. The proprotein is thought to be further cleaved within a cysteine-rich G-protein-coupled receptor proteolysis site into two chains that are non-covalently bound at the cell membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null mice die prenatally at fetal stages. Heterozygous mice exhibit decreased locomotor activity in an open field test. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik G T 6: 72,347,454 G16C probably damaging Het
Abca7 G A 10: 80,004,410 V801I probably benign Het
Akap1 T C 11: 88,844,568 T423A possibly damaging Het
Anpep T A 7: 79,825,802 D111V probably damaging Het
Atm T A 9: 53,445,376 probably null Het
Atp5a1 T A 18: 77,778,468 S106T probably benign Het
Atp5k T C 5: 108,434,059 I20V probably benign Het
Atp6v0d2 T A 4: 19,922,605 probably null Het
Bclaf1 T G 10: 20,322,160 probably null Het
Bod1l A G 5: 41,818,787 V1728A probably benign Het
Braf A G 6: 39,688,282 F51L possibly damaging Het
Camsap2 A G 1: 136,304,437 I140T possibly damaging Het
Ccdc24 A T 4: 117,869,653 probably null Het
Cdh26 G C 2: 178,449,884 G79R probably damaging Het
Cenpf A G 1: 189,652,742 L2447P probably damaging Het
Cfap74 T C 4: 155,451,796 F863L probably damaging Het
Clstn2 C T 9: 97,454,674 G917S probably benign Het
Col6a6 A T 9: 105,727,227 probably null Het
Cul5 G A 9: 53,623,735 P596L probably damaging Het
Dst A T 1: 34,229,085 R2863W probably damaging Het
Dthd1 A G 5: 62,814,041 E69G possibly damaging Het
Erich2 T A 2: 70,539,684 I402N probably damaging Het
Fam160a1 G A 3: 85,672,688 P737S probably benign Het
Fam162b T C 10: 51,585,502 K155R probably damaging Het
Glb1l2 A T 9: 26,767,448 S466T probably benign Het
Gm21994 T A 2: 150,255,278 Y77F possibly damaging Het
Gm5724 T C 6: 141,725,393 D451G probably damaging Het
Ikbkap A T 4: 56,762,281 I1106K probably damaging Het
Kazn G A 4: 142,117,197 L402F probably benign Het
Kcnj13 A T 1: 87,386,886 S205T probably damaging Het
Lama1 T A 17: 67,810,096 V2462E probably damaging Het
Lce1b A C 3: 92,656,104 C41G unknown Het
Lyar T A 5: 38,225,995 W77R probably damaging Het
March11 G A 15: 26,409,346 R377Q probably benign Het
Mis18bp1 A G 12: 65,138,787 F869L probably benign Het
Myom1 T A 17: 71,022,892 Y6* probably null Het
Myzap T C 9: 71,558,925 I150V probably benign Het
Nop14 C T 5: 34,641,491 probably null Het
Oprl1 T A 2: 181,717,991 probably benign Het
Pacsin1 T C 17: 27,708,504 L432P probably damaging Het
Peak1 A G 9: 56,260,296 L116P probably benign Het
Plcb2 C T 2: 118,717,301 V482M probably benign Het
Pnliprp1 T A 19: 58,734,984 I269N probably damaging Het
Pnpla7 C A 2: 25,016,618 D664E possibly damaging Het
Ppa2 G A 3: 133,370,417 R269H probably benign Het
Rps6kb2 G T 19: 4,161,187 T113K probably benign Het
Rrp7a A T 15: 83,121,860 I63N probably damaging Het
Slc29a1 A G 17: 45,589,921 probably null Het
Stxbp5 A C 10: 9,767,179 S1059A probably benign Het
Stxbp5 C A 10: 9,767,187 G1056V probably damaging Het
Taldo1 T A 7: 141,398,583 S149T possibly damaging Het
Tlr1 T C 5: 64,927,099 D45G possibly damaging Het
Tnrc6a T C 7: 123,171,335 S783P probably damaging Het
Trap1 A G 16: 4,060,809 Y220H probably benign Het
Trpc6 A G 9: 8,643,600 D462G possibly damaging Het
Ttc21a A G 9: 119,943,962 E235G probably damaging Het
Tubb4a A G 17: 57,080,833 Y398H probably damaging Het
Ube2z A G 11: 96,050,407 F303S probably damaging Het
Vmn1r211 A G 13: 22,852,084 S138P probably damaging Het
Zfp93 T A 7: 24,275,629 C346* probably null Het
Zfp938 A T 10: 82,227,566 S52R possibly damaging Het
Zp1 A T 19: 10,916,503 L446Q probably damaging Het
Other mutations in Adgrl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Adgrl2 APN 3 148865608 missense probably damaging 0.99
IGL00572:Adgrl2 APN 3 148826498 missense probably damaging 1.00
IGL01624:Adgrl2 APN 3 148836527 missense probably damaging 1.00
IGL01796:Adgrl2 APN 3 148858975 missense probably damaging 1.00
IGL02380:Adgrl2 APN 3 148828489 nonsense probably null
IGL02468:Adgrl2 APN 3 148890480 missense probably damaging 1.00
IGL02708:Adgrl2 APN 3 148826525 missense probably damaging 0.96
IGL02869:Adgrl2 APN 3 148890605 missense probably damaging 1.00
IGL03248:Adgrl2 APN 3 148817400 missense probably damaging 1.00
IGL03343:Adgrl2 APN 3 148859380 missense probably damaging 0.98
P0157:Adgrl2 UTSW 3 148859063 missense probably damaging 1.00
PIT4382001:Adgrl2 UTSW 3 148817298 missense
PIT4544001:Adgrl2 UTSW 3 148890521 missense probably damaging 1.00
R0165:Adgrl2 UTSW 3 148852863 splice site probably benign
R0242:Adgrl2 UTSW 3 148839185 unclassified probably null
R0242:Adgrl2 UTSW 3 148839185 unclassified probably null
R0344:Adgrl2 UTSW 3 148865595 splice site probably null
R0488:Adgrl2 UTSW 3 148846905 missense probably damaging 1.00
R0542:Adgrl2 UTSW 3 148859218 missense probably damaging 1.00
R0630:Adgrl2 UTSW 3 148839244 missense probably damaging 0.98
R0674:Adgrl2 UTSW 3 148837679 missense possibly damaging 0.91
R1401:Adgrl2 UTSW 3 148822981 missense probably damaging 0.99
R1543:Adgrl2 UTSW 3 148859273 missense probably damaging 1.00
R1575:Adgrl2 UTSW 3 148852762 missense probably benign 0.17
R1645:Adgrl2 UTSW 3 148865608 missense probably damaging 1.00
R1780:Adgrl2 UTSW 3 148852593 missense probably damaging 1.00
R1992:Adgrl2 UTSW 3 148817244 missense possibly damaging 0.89
R2014:Adgrl2 UTSW 3 148826475 missense probably damaging 1.00
R2130:Adgrl2 UTSW 3 148890488 missense probably damaging 0.99
R2131:Adgrl2 UTSW 3 148890488 missense probably damaging 0.99
R2400:Adgrl2 UTSW 3 148851934 missense probably damaging 1.00
R2997:Adgrl2 UTSW 3 148817649 missense probably damaging 1.00
R3161:Adgrl2 UTSW 3 148817551 missense probably damaging 1.00
R3416:Adgrl2 UTSW 3 148859329 missense probably damaging 1.00
R3417:Adgrl2 UTSW 3 148859329 missense probably damaging 1.00
R3551:Adgrl2 UTSW 3 148858963 missense probably damaging 1.00
R3760:Adgrl2 UTSW 3 148817235 missense probably damaging 1.00
R4355:Adgrl2 UTSW 3 148839152 missense probably damaging 1.00
R4850:Adgrl2 UTSW 3 148859020 missense probably damaging 1.00
R4911:Adgrl2 UTSW 3 148890463 missense probably damaging 0.99
R4945:Adgrl2 UTSW 3 148823036 missense probably damaging 0.99
R5313:Adgrl2 UTSW 3 148823713 missense probably damaging 1.00
R5339:Adgrl2 UTSW 3 148817844 missense probably benign 0.01
R5540:Adgrl2 UTSW 3 148837562 critical splice donor site probably null
R5583:Adgrl2 UTSW 3 148859164 missense probably damaging 1.00
R5890:Adgrl2 UTSW 3 148859175 missense probably damaging 1.00
R6170:Adgrl2 UTSW 3 148823009 missense probably damaging 1.00
R6197:Adgrl2 UTSW 3 148858942 missense probably damaging 1.00
R6877:Adgrl2 UTSW 3 148817286 missense probably damaging 1.00
R7048:Adgrl2 UTSW 3 148846929 missense probably damaging 1.00
R7205:Adgrl2 UTSW 3 148858949 missense probably damaging 1.00
X0009:Adgrl2 UTSW 3 148852654 missense probably damaging 1.00
X0019:Adgrl2 UTSW 3 148865594 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTTCAAGTCCAAGGCCAAGGG -3'
(R):5'- AAGCTGCAGTACTAAATGCTCTTC -3'

Sequencing Primer
(F):5'- GCACTGAGCCTCTCCCCAG -3'
(R):5'- TCTTAATCAGCGGAAGGTTAAAGCC -3'
Posted On2018-03-15