Incidental Mutation 'R6284:Bclaf1'
ID508123
Institutional Source Beutler Lab
Gene Symbol Bclaf1
Ensembl Gene ENSMUSG00000037608
Gene NameBCL2-associated transcription factor 1
Synonyms5730534O06Rik, 2810454G14Rik, 2700025J07Rik, 2610102K23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6284 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location20312469-20344613 bp(+) (GRCm38)
Type of Mutationintron (44 bp from exon)
DNA Base Change (assembly) T to G at 20322160 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043881] [ENSMUST00000092678] [ENSMUST00000185800] [ENSMUST00000186100] [ENSMUST00000189158] [ENSMUST00000190156] [ENSMUST00000191438]
Predicted Effect probably null
Transcript: ENSMUST00000043881
SMART Domains Protein: ENSMUSP00000043583
Gene: ENSMUSG00000037608

DomainStartEndE-ValueType
low complexity region 3 94 N/A INTRINSIC
Pfam:THRAP3_BCLAF1 108 766 1.6e-181 PFAM
low complexity region 793 824 N/A INTRINSIC
low complexity region 861 874 N/A INTRINSIC
low complexity region 898 919 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000092678
SMART Domains Protein: ENSMUSP00000090349
Gene: ENSMUSG00000037608

DomainStartEndE-ValueType
low complexity region 3 94 N/A INTRINSIC
Pfam:THRAP3_BCLAF1 108 789 5.4e-191 PFAM
low complexity region 812 825 N/A INTRINSIC
low complexity region 849 870 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000185800
SMART Domains Protein: ENSMUSP00000140623
Gene: ENSMUSG00000037608

DomainStartEndE-ValueType
low complexity region 3 92 N/A INTRINSIC
Pfam:THRAP3_BCLAF1 106 787 7.2e-191 PFAM
low complexity region 791 822 N/A INTRINSIC
low complexity region 859 872 N/A INTRINSIC
low complexity region 896 917 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186100
SMART Domains Protein: ENSMUSP00000140101
Gene: ENSMUSG00000037608

DomainStartEndE-ValueType
low complexity region 3 94 N/A INTRINSIC
Pfam:THRAP3_BCLAF1 108 742 6.4e-177 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187338
Predicted Effect probably benign
Transcript: ENSMUST00000189158
Predicted Effect probably benign
Transcript: ENSMUST00000190156
SMART Domains Protein: ENSMUSP00000140428
Gene: ENSMUSG00000037608

DomainStartEndE-ValueType
low complexity region 3 92 N/A INTRINSIC
Pfam:THRAP3_BCLAF1 106 740 4.2e-180 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191438
SMART Domains Protein: ENSMUSP00000140702
Gene: ENSMUSG00000037608

DomainStartEndE-ValueType
Pfam:THRAP3_BCLAF1 1 502 1.3e-140 PFAM
low complexity region 525 538 N/A INTRINSIC
low complexity region 562 583 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215262
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional repressor that interacts with several members of the BCL2 family of proteins. Overexpression of this protein induces apoptosis, which can be suppressed by co-expression of BCL2 proteins. The protein localizes to dot-like structures throughout the nucleus, and redistributes to a zone near the nuclear envelope in cells undergoing apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, impaired lung development, and T cell and B cell homeostasis abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik G T 6: 72,347,454 G16C probably damaging Het
Abca7 G A 10: 80,004,410 V801I probably benign Het
Adgrl2 A T 3: 148,826,507 L1030Q probably damaging Het
Akap1 T C 11: 88,844,568 T423A possibly damaging Het
Anpep T A 7: 79,825,802 D111V probably damaging Het
Atm T A 9: 53,445,376 probably null Het
Atp5a1 T A 18: 77,778,468 S106T probably benign Het
Atp5k T C 5: 108,434,059 I20V probably benign Het
Atp6v0d2 T A 4: 19,922,605 probably null Het
Bod1l A G 5: 41,818,787 V1728A probably benign Het
Braf A G 6: 39,688,282 F51L possibly damaging Het
Camsap2 A G 1: 136,304,437 I140T possibly damaging Het
Ccdc24 A T 4: 117,869,653 probably null Het
Cdh26 G C 2: 178,449,884 G79R probably damaging Het
Cenpf A G 1: 189,652,742 L2447P probably damaging Het
Cfap74 T C 4: 155,451,796 F863L probably damaging Het
Clstn2 C T 9: 97,454,674 G917S probably benign Het
Col6a6 A T 9: 105,727,227 probably null Het
Cul5 G A 9: 53,623,735 P596L probably damaging Het
Dst A T 1: 34,229,085 R2863W probably damaging Het
Dthd1 A G 5: 62,814,041 E69G possibly damaging Het
Erich2 T A 2: 70,539,684 I402N probably damaging Het
Fam160a1 G A 3: 85,672,688 P737S probably benign Het
Fam162b T C 10: 51,585,502 K155R probably damaging Het
Glb1l2 A T 9: 26,767,448 S466T probably benign Het
Gm21994 T A 2: 150,255,278 Y77F possibly damaging Het
Gm5724 T C 6: 141,725,393 D451G probably damaging Het
Ikbkap A T 4: 56,762,281 I1106K probably damaging Het
Kazn G A 4: 142,117,197 L402F probably benign Het
Kcnj13 A T 1: 87,386,886 S205T probably damaging Het
Lama1 T A 17: 67,810,096 V2462E probably damaging Het
Lce1b A C 3: 92,656,104 C41G unknown Het
Lyar T A 5: 38,225,995 W77R probably damaging Het
March11 G A 15: 26,409,346 R377Q probably benign Het
Mis18bp1 A G 12: 65,138,787 F869L probably benign Het
Myom1 T A 17: 71,022,892 Y6* probably null Het
Myzap T C 9: 71,558,925 I150V probably benign Het
Nop14 C T 5: 34,641,491 probably null Het
Oprl1 T A 2: 181,717,991 probably benign Het
Pacsin1 T C 17: 27,708,504 L432P probably damaging Het
Peak1 A G 9: 56,260,296 L116P probably benign Het
Plcb2 C T 2: 118,717,301 V482M probably benign Het
Pnliprp1 T A 19: 58,734,984 I269N probably damaging Het
Pnpla7 C A 2: 25,016,618 D664E possibly damaging Het
Ppa2 G A 3: 133,370,417 R269H probably benign Het
Rps6kb2 G T 19: 4,161,187 T113K probably benign Het
Rrp7a A T 15: 83,121,860 I63N probably damaging Het
Slc29a1 A G 17: 45,589,921 probably null Het
Stxbp5 A C 10: 9,767,179 S1059A probably benign Het
Stxbp5 C A 10: 9,767,187 G1056V probably damaging Het
Taldo1 T A 7: 141,398,583 S149T possibly damaging Het
Tlr1 T C 5: 64,927,099 D45G possibly damaging Het
Tnrc6a T C 7: 123,171,335 S783P probably damaging Het
Trap1 A G 16: 4,060,809 Y220H probably benign Het
Trpc6 A G 9: 8,643,600 D462G possibly damaging Het
Ttc21a A G 9: 119,943,962 E235G probably damaging Het
Tubb4a A G 17: 57,080,833 Y398H probably damaging Het
Ube2z A G 11: 96,050,407 F303S probably damaging Het
Vmn1r211 A G 13: 22,852,084 S138P probably damaging Het
Zfp93 T A 7: 24,275,629 C346* probably null Het
Zfp938 A T 10: 82,227,566 S52R possibly damaging Het
Zp1 A T 19: 10,916,503 L446Q probably damaging Het
Other mutations in Bclaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Bclaf1 APN 10 20325999 missense probably damaging 0.99
IGL01087:Bclaf1 APN 10 20325310 missense probably damaging 0.99
IGL02001:Bclaf1 APN 10 20323016 unclassified probably benign
IGL02380:Bclaf1 APN 10 20325367 missense possibly damaging 0.93
IGL02618:Bclaf1 APN 10 20323528 missense probably damaging 1.00
R0629:Bclaf1 UTSW 10 20333426 missense probably damaging 1.00
R0884:Bclaf1 UTSW 10 20322076 nonsense probably null
R1013:Bclaf1 UTSW 10 20332076 splice site probably benign
R1611:Bclaf1 UTSW 10 20323252 unclassified probably benign
R2228:Bclaf1 UTSW 10 20339878 utr 3 prime probably benign
R3689:Bclaf1 UTSW 10 20325397 missense possibly damaging 0.84
R3690:Bclaf1 UTSW 10 20325397 missense possibly damaging 0.84
R4290:Bclaf1 UTSW 10 20323778 missense probably damaging 1.00
R4292:Bclaf1 UTSW 10 20323778 missense probably damaging 1.00
R4831:Bclaf1 UTSW 10 20322126 unclassified probably benign
R5238:Bclaf1 UTSW 10 20332384 intron probably benign
R5254:Bclaf1 UTSW 10 20323536 missense possibly damaging 0.71
R5354:Bclaf1 UTSW 10 20333532 missense probably damaging 1.00
R5386:Bclaf1 UTSW 10 20325592 missense possibly damaging 0.95
R5712:Bclaf1 UTSW 10 20333531 missense probably damaging 1.00
R5982:Bclaf1 UTSW 10 20323063 nonsense probably null
R6147:Bclaf1 UTSW 10 20323425 missense possibly damaging 0.93
R6218:Bclaf1 UTSW 10 20334628 missense probably benign 0.27
R6738:Bclaf1 UTSW 10 20323769 missense possibly damaging 0.91
R7085:Bclaf1 UTSW 10 20322022 missense unknown
Predicted Primers PCR Primer
(F):5'- CTGACATTGCTCCGAAGTTGG -3'
(R):5'- CCAGCTTATCTCTTAAGACGTAAAG -3'

Sequencing Primer
(F):5'- TTGAGGTGCATAGGAGATAAGTTC -3'
(R):5'- CCCATCATGTATTAACACCATACAG -3'
Posted On2018-03-15