Incidental Mutation 'R6285:Hipk3'
ID508150
Institutional Source Beutler Lab
Gene Symbol Hipk3
Ensembl Gene ENSMUSG00000027177
Gene Namehomeodomain interacting protein kinase 3
SynonymsDYRK6, FIST3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6285 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location104426481-104494446 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104471425 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 141 (M141V)
Ref Sequence ENSEMBL: ENSMUSP00000106754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028600] [ENSMUST00000111124] [ENSMUST00000111125]
Predicted Effect probably benign
Transcript: ENSMUST00000028600
AA Change: M141V

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000028600
Gene: ENSMUSG00000027177
AA Change: M141V

DomainStartEndE-ValueType
S_TKc 197 525 1.58e-76 SMART
low complexity region 844 859 N/A INTRINSIC
low complexity region 887 906 N/A INTRINSIC
low complexity region 1093 1117 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111124
AA Change: M141V

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000106753
Gene: ENSMUSG00000027177
AA Change: M141V

DomainStartEndE-ValueType
S_TKc 197 525 1.58e-76 SMART
low complexity region 844 859 N/A INTRINSIC
low complexity region 887 906 N/A INTRINSIC
low complexity region 1093 1117 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111125
AA Change: M141V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106754
Gene: ENSMUSG00000027177
AA Change: M141V

DomainStartEndE-ValueType
S_TKc 197 525 1.58e-76 SMART
low complexity region 865 880 N/A INTRINSIC
low complexity region 908 927 N/A INTRINSIC
low complexity region 1114 1138 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.9%
Validation Efficiency 100% (68/68)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit impaired insulin secretion and glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik A G 18: 59,072,224 K28R probably benign Het
Acad9 A T 3: 36,082,175 M370L probably benign Het
Aimp1 A G 3: 132,667,504 M225T possibly damaging Het
Atp8a1 T C 5: 67,667,607 I809V possibly damaging Het
Bbs10 A G 10: 111,299,761 Y245C probably damaging Het
Cabin1 A T 10: 75,684,323 F1572Y probably damaging Het
Cd79a A G 7: 24,899,347 N107S possibly damaging Het
Cdc7 G A 5: 106,983,059 A428T probably benign Het
Cep290 A G 10: 100,523,329 T974A probably benign Het
Cep350 A T 1: 155,953,374 N261K possibly damaging Het
Cfap46 T A 7: 139,661,085 D8V probably damaging Het
Col6a4 T C 9: 106,074,986 D571G probably damaging Het
Cpe A C 8: 64,617,611 V200G probably benign Het
Ctnnd1 C T 2: 84,613,887 probably null Het
D5Ertd579e A C 5: 36,615,577 C491W probably damaging Het
Dek A G 13: 47,099,380 I183T probably damaging Het
Dennd1a A T 2: 37,852,441 H437Q possibly damaging Het
Dido1 C T 2: 180,661,147 A1655T probably benign Het
Eva1b A G 4: 126,149,485 D106G probably damaging Het
Evc2 G T 5: 37,424,579 S1189I possibly damaging Het
Faap100 A T 11: 120,376,732 L405Q probably damaging Het
Fbxw15 T A 9: 109,557,166 M249L probably benign Het
Gbp10 A T 5: 105,218,460 L526Q probably damaging Het
Gm13084 A G 4: 143,816,039 C4R probably damaging Het
Gm14025 T G 2: 129,037,799 T736P possibly damaging Het
Gm19402 A C 10: 77,690,520 probably benign Het
Gm2244 A G 14: 19,540,797 Y141H probably damaging Het
Gm4181 A T 14: 51,633,209 N98K probably damaging Het
Gm765 T C 6: 98,238,173 D163G probably damaging Het
Golga4 C T 9: 118,558,627 R616* probably null Het
Gpank1 T A 17: 35,124,290 S226T probably damaging Het
Hoxc11 T C 15: 102,954,743 V73A probably benign Het
Igf1r T G 7: 68,004,137 I141S possibly damaging Het
Jak2 T A 19: 29,295,659 F628I probably benign Het
Kcp C A 6: 29,502,365 V227L probably benign Het
Knl1 T G 2: 119,071,941 C1374W probably damaging Het
Larp6 A T 9: 60,737,760 R394S probably benign Het
Lilra5 G A 7: 4,242,115 G253R probably damaging Het
Map3k4 A G 17: 12,264,058 S591P probably damaging Het
Mrpl16 T A 19: 11,772,968 I72K probably damaging Het
Nol11 C G 11: 107,181,034 R244S probably benign Het
Nr2f1 T C 13: 78,195,663 T161A probably benign Het
Nrd1 G T 4: 109,038,006 V476F probably damaging Het
Olfr1406 G T 1: 173,183,910 H175N probably damaging Het
Olfr419 A T 1: 174,250,829 S33T possibly damaging Het
Olfr451-ps1 A T 6: 42,800,909 H56L probably benign Het
Olfr535 T A 7: 140,492,713 L25Q possibly damaging Het
P2rx1 A G 11: 73,008,148 I62V probably benign Het
Pcdhgc5 A T 18: 37,820,621 Y316F probably benign Het
Pecam1 T C 11: 106,685,239 D490G probably benign Het
Pfkfb2 A T 1: 130,707,562 Y87* probably null Het
Poldip2 A G 11: 78,517,632 probably null Het
Ppp2r5b T A 19: 6,230,536 Q304L probably benign Het
Psg26 A G 7: 18,482,828 F29L probably benign Het
Ptk6 A T 2: 181,197,093 L289Q probably null Het
Ptprt A T 2: 161,901,497 I508N possibly damaging Het
Rasgrp4 T C 7: 29,148,383 F406S probably damaging Het
Rspo3 A G 10: 29,499,930 probably null Het
Sept8 G T 11: 53,534,767 probably null Het
Sirt2 A C 7: 28,788,046 T345P probably benign Het
Slc6a20b T C 9: 123,609,096 E205G possibly damaging Het
Sqstm1 G A 11: 50,202,591 Q327* probably null Het
Susd3 T A 13: 49,237,521 S98C probably damaging Het
Tada2b G A 5: 36,476,842 R56W probably damaging Het
Tbc1d2 A T 4: 46,615,045 V546E possibly damaging Het
Tbx6 A G 7: 126,781,568 Q21R possibly damaging Het
Usp24 T G 4: 106,374,100 probably null Het
Vmn2r103 A G 17: 19,812,144 T727A probably benign Het
Wdr48 C T 9: 119,920,610 T531M probably damaging Het
Other mutations in Hipk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Hipk3 APN 2 104430231 missense possibly damaging 0.52
IGL00937:Hipk3 APN 2 104433172 missense possibly damaging 0.82
IGL01719:Hipk3 APN 2 104437089 missense possibly damaging 0.78
IGL01802:Hipk3 APN 2 104471853 splice site probably benign
IGL01932:Hipk3 APN 2 104470981 missense probably damaging 1.00
IGL02089:Hipk3 APN 2 104431379 missense probably damaging 1.00
IGL02522:Hipk3 APN 2 104471331 missense probably damaging 1.00
IGL02525:Hipk3 APN 2 104471412 missense probably damaging 1.00
IGL02959:Hipk3 APN 2 104471259 missense probably damaging 1.00
IGL02986:Hipk3 APN 2 104433741 missense probably damaging 1.00
R0136:Hipk3 UTSW 2 104439293 missense probably benign 0.02
R0277:Hipk3 UTSW 2 104441248 missense probably damaging 1.00
R0308:Hipk3 UTSW 2 104433207 missense probably damaging 0.99
R0367:Hipk3 UTSW 2 104431249 nonsense probably null
R0597:Hipk3 UTSW 2 104433637 missense possibly damaging 0.94
R1079:Hipk3 UTSW 2 104471698 missense probably benign 0.00
R1171:Hipk3 UTSW 2 104471676 missense probably benign 0.02
R1244:Hipk3 UTSW 2 104433256 missense probably damaging 1.00
R1509:Hipk3 UTSW 2 104441262 missense probably benign 0.01
R1616:Hipk3 UTSW 2 104433745 nonsense probably null
R1893:Hipk3 UTSW 2 104433256 missense probably damaging 1.00
R1938:Hipk3 UTSW 2 104430188 missense possibly damaging 0.89
R1969:Hipk3 UTSW 2 104433841 missense probably damaging 1.00
R1975:Hipk3 UTSW 2 104471173 missense probably benign 0.00
R1985:Hipk3 UTSW 2 104434435 missense probably benign 0.16
R2105:Hipk3 UTSW 2 104439392 missense probably damaging 0.97
R2422:Hipk3 UTSW 2 104471485 missense probably benign 0.01
R3028:Hipk3 UTSW 2 104433790 missense probably benign
R3747:Hipk3 UTSW 2 104441283 nonsense probably null
R3923:Hipk3 UTSW 2 104470762 missense probably damaging 1.00
R4320:Hipk3 UTSW 2 104446571 missense probably damaging 1.00
R4321:Hipk3 UTSW 2 104446571 missense probably damaging 1.00
R4322:Hipk3 UTSW 2 104446571 missense probably damaging 1.00
R4323:Hipk3 UTSW 2 104446571 missense probably damaging 1.00
R4324:Hipk3 UTSW 2 104446571 missense probably damaging 1.00
R4595:Hipk3 UTSW 2 104441277 missense probably benign 0.01
R4604:Hipk3 UTSW 2 104439329 missense probably damaging 1.00
R4657:Hipk3 UTSW 2 104433759 missense probably benign 0.00
R5193:Hipk3 UTSW 2 104430000 missense possibly damaging 0.94
R5769:Hipk3 UTSW 2 104434953 missense possibly damaging 0.69
R5843:Hipk3 UTSW 2 104440224 missense possibly damaging 0.65
R5906:Hipk3 UTSW 2 104471808 missense probably damaging 1.00
R5976:Hipk3 UTSW 2 104471184 missense probably damaging 1.00
R5991:Hipk3 UTSW 2 104437983 missense probably damaging 1.00
R6214:Hipk3 UTSW 2 104433741 missense probably damaging 1.00
R6215:Hipk3 UTSW 2 104433741 missense probably damaging 1.00
R6523:Hipk3 UTSW 2 104439408 missense possibly damaging 0.50
R6713:Hipk3 UTSW 2 104446571 missense probably damaging 1.00
R7381:Hipk3 UTSW 2 104439351 missense probably damaging 0.99
X0021:Hipk3 UTSW 2 104441366 critical splice acceptor site probably null
Z1088:Hipk3 UTSW 2 104434629 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCATTTGACAACCTGGCC -3'
(R):5'- CCATTGTTGTCAAAGACACTGC -3'

Sequencing Primer
(F):5'- TTTGACAACCTGGCCAAAAGTG -3'
(R):5'- ACTGCCGGTGCTACAAAG -3'
Posted On2018-03-15